subject

Mathematics, 18.12.2021 02:20 chickedy5490

Which of the following ordered pairs located in quadrant 4? A. (-2,1)
B. (-2,1)
C. (2,1)
D. (2,-1)

ansver

Answers: 2

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 16:00

12. the amount of money in a bank account decreased by 21.5% over the last year. if the amount of money at the beginning of the year is represented by ‘n', write 3 equivalent expressions to represent the amount of money in the bank account after the decrease?

Answers: 2

question

Mathematics, 21.06.2019 17:00

The angle of a triangle are given as 6x,(x-3), and (3x+7). find x then find the measures of the angles

Answers: 2

question

Mathematics, 21.06.2019 17:30

Find the difference (8ab+a+2) - (3ab+6)

Answers: 1

question

Mathematics, 21.06.2019 22:00

The serenity and the mystic are sail boats. the serenity and the mystic start at the same point and travel away from each other in opposite directions. the serenity travels at 16 mph and the mystic travels at 19 mph. how far apart will they be in 3 hours?

Answers: 1

You know the right answer?

Which of the following ordered pairs located in quadrant 4? A. (-2,1)
B. (-2,1)
C. (2,...

Questions

question

History, 22.06.2020 11:57

Write a short essay describing your goal, the political party or interest group you chose, and the media form you selected. Explain how these choices...

question

Mathematics, 22.06.2020 11:57

. A particle moves along a straight line according to s(t) = sin(πt) + 2t^3. a) Determine the acceleration at t = 4.b) Is the particle mo...

question

Biology, 22.06.2020 11:57

If I have a phylogenetic tree where 4 individuals are from the same family and 1 individual is from a different family, is it a monophyletic or paraph...

question

Arts, 22.06.2020 11:57

In addition to the information about wild horses joining the Marine Corps Mounted Color Guard, this passage is mainly about...

question

History, 22.06.2020 11:57

Why did many colonists persist in resisting British attempts to tax them? They disagreed with the idea of taxation without representation. They...

question

Arts, 22.06.2020 11:57

What can we learn about Greek performance traditions from Oedipus the King?...

question

Mathematics, 22.06.2020 11:57

you secure a mortgage to buy a house with a loan of $140,000 at 8.5% for 20 years. answer the following questions about that loan for the first two mo...

question

Social Studies, 22.06.2020 11:57

Concepto de territorio...

question

Mathematics, 22.06.2020 11:57

Sean wants to buy a personal insurance policy that will pay monthly benefits to his son after Sean dies. He pays $500 monthly over the next 10 years...

question

Mathematics, 22.06.2020 11:57

A marble dropped in still water will create circular ripples or waves. The radius of each circular wave will increase 4 centimeters per second. What...

question

Mathematics, 22.06.2020 11:57

Nstruction Active Proving That All Circles Are Similar Statements Reasons Given: Circle X with radius r and circle Y with rad...

question

Mathematics, 22.06.2020 11:57

NEED ANSWER NOWGraph a triangle (LMN) and reflect it over the line y=x to create triangle L’M’N Descirbe the transformation using words. Draw a line s...

question

Chemistry, 22.06.2020 11:57

Question * (4 Points) Solid E was iron(11) sulfate. Complete the expected observations. Solid E was added to distilled water in a test-tu...

question

Business, 22.06.2020 11:57

Melissa and Melinda, both calendar-year taxpayers, each own a 20% interest in Partnership tnt techron inc, whose fiscal years ends on June 30th 2019,...

question

English, 22.06.2020 11:57

Read the excerpt below and answer the question. As I said these things I got scared. It felt like worms and toads and slimy things crawling out of my...

question

Biology, 22.06.2020 11:57

1. The following sequence was taken from a DNA molecule 5'- AACCTTTAGGGCCCTTTAAA - 3'Given that the temperature required breaking, one bond in...

question

Mathematics, 22.06.2020 11:57

3 What is the y-coordinate of the point that divides the directed line segment from J to k into a ratio of 5:1? 2 1 AK (7,2

question

History, 22.06.2020 11:57

Which statement below most accurately describes the moral arguments for and against slavery in the 1800s? Supported of slavery insisted I...

question

Mathematics, 22.06.2020 12:57

A hotel with 95 room has 65 for doubles and 25 for singles. Singles can be booked in any room, but reservations for two or more people must be booked...

question

Mathematics, 22.06.2020 12:57

Cumulative Exam Active 21 30 TIME REMAINING 02:34:47 c A triangle on a coordinate plane is translated according t...

More questions: Mathematics Another questions