1. The following sequence was taken from a DNA molecule
5'- AACCTTTAGGGCCCTTTAAA - 3'
Given th...
1. The following sequence was taken from a DNA molecule
5'- AACCTTTAGGGCCCTTTAAA - 3'
Given that the temperature required breaking, one bond in the molecule is 12°C. What is
the total temperature required to completely break the entire DNA molecule.
a 48°C
b. 57.6°C
C. 240°C
d. 480°C
e. 576°C
Answers: 2
Biology, 21.06.2019 19:50
Which statements correspond to cellular respiration? co2 diffuses passively into the cell. co2 diffuses passively out of the cell. co2 must be pumped out of the cell. o2 diffuses passively when produced inside the cell. o2 diffuses passively when converted to co2. o2 is pumped in and forces co2 out.
Answers: 3
Biology, 22.06.2019 00:20
1. variations in a population of moths allow for some of its members to be able to adapt to environmental changes. the better adapted of the moths will be able to survive the change and thus prevail as the “fittest” of the species. (a) describe three mechanisms in which variation can occur within a species population. (b) explain which mechanism or mechanisms would be responsible for the survival of a population of peppered moths better than white moths in an environment affected by industrial soot. justify your answer.
Answers: 1
Biology, 22.06.2019 04:50
Waianapanapa beach in hawaii is a black-sand beach that was formed by waves crashing against volcanic rock. the sand can be very hot on sunny days. which statement best explains why? o a. the black sand has no heat capacity. b. the black sand absorbs no radiation. o c. the black sand is immune to insolation. d. the black sand has a low albedo.
Answers: 1
Biology, 22.06.2019 06:30
How have high taxes on tobacco products impacted the number of people who use them? a. the number of tobacco users has increased. b. the number of tobacco users has decreased. c. the number of tobacco users has not changed. d. the number of adolescent tobacco users decreased, while the number of adult users increased
Answers: 2
History, 09.11.2019 21:31
English, 09.11.2019 21:31
Mathematics, 09.11.2019 21:31
Chemistry, 09.11.2019 21:31
History, 09.11.2019 21:31
Computers and Technology, 09.11.2019 21:31
Social Studies, 09.11.2019 21:31
Social Studies, 09.11.2019 21:31
Physics, 09.11.2019 21:31
History, 09.11.2019 21:31