Mathematics, 13.03.2020 17:30 bubs9789

How large are hamster litters? Among 47 golden hamster litters recorded, there were an average of 7.72 baby hamsters, with a standard deviation of 2.5 hamsters per litter. For this scenario, which is the most appropriate option:

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 14:00

Rewrite the following without an exponent. (5/8)-1

Answers: 1

Answer

Mathematics, 21.06.2019 14:10

What is the value of the digit 1 in the number 13?

Answers: 2

Answer

Mathematics, 21.06.2019 15:50

Create and solve a linear equation that represents the model, where squares and triangles are shown evenly balanced on a balance beam. assume the weight of a square is 1 unit and the weight of a triangle is unknown.

Answers: 3

Answer

Mathematics, 21.06.2019 18:30

Is the square root of 4 plus the square root of 16 rational?

Answers: 2

Answer

You know the right answer?

How large are hamster litters? Among 47 golden hamster litters recorded, there were an average of 7....

Questions

Mathematics, 11.03.2021 01:00

Please Help! I will mark brainalist!! Select the correct answer The owner of a sporting goods store gathered data about the numbers of men's, w...

Mathematics, 11.03.2021 01:00

What is he sum of 4/10 and 40/100...

Mathematics, 11.03.2021 01:00

Jackrabbits are capable of reaching speeds up to 40 miles per hour how fast is this per second...

History, 11.03.2021 01:00

What is Roanoke Colony?...

English, 11.03.2021 01:00

Match the central idea or aspect of God described by William Blake to the lines of the poems "The Tyger" and "The Lamb."...

Mathematics, 11.03.2021 01:00

plz plzz help my mom said if i get my math grade and pass 9th grade she will let me get my learners perment during summer so plz help i really wanna g...

Mathematics, 11.03.2021 01:00

A new pair of jeans costs $129. 97 and the sales tax rate is 8.38%. You only have $140 to spend. Do you have enough money to purchase the jeans? Expla...

Biology, 11.03.2021 01:00

Question 12 of 20 Which of the following are goals of the Convention on Biological Diversity? 1. Conservation II. Sustainable uses...

Mathematics, 11.03.2021 01:00

CAN SOMEONE PLSSS HELP ME ...

Mathematics, 11.03.2021 01:00

WILL GIVE BRAINLST hAVE AN AMAZING DAY ...

Biology, 11.03.2021 01:00

The respiratory system controls , and the circulatory systems controls . 1. antibodies; digestion 2. breathing; blood flow 3. muscles; bo...

English, 11.03.2021 01:00

In paragraphs 3-4, how does the author make the connection between facial recognition and reading emotions? by explaining how reading emo...

Mathematics, 11.03.2021 01:00

Answer and explain I’ll mark brainliest ...

English, 11.03.2021 01:00

1. How do the citizens react to the fighting ? Why might they feel this way ?...

History, 11.03.2021 01:00

Under Roosevelt's New Deal program, which group below would NOT have been one of the first helped?...

Mathematics, 11.03.2021 01:00

A DVD has a diameter of 12 centimeters. What is the area of the DVD? Round your answer to the nearest hundreth. Use 3.14 for Pi. (Remember A = 3.14 ·...

Biology, 11.03.2021 01:00

Please help me The DNA base sequence for a short gene is TATGATACCTTGATAGCTATGTGATTG What is the amino acid sequence of the polypeptide p...

Mathematics, 11.03.2021 01:00

Help me plz ill give extra points ...

Mathematics, 11.03.2021 01:00

The line L passes through the point p (2,4) and Q (6,10) calculate:the gradient of line L...

Physics, 11.03.2021 01:00

Order the imagines of earth plates in order from oldest of earliest...

More questions: Mathematics Another questions