Please help me The DNA base sequence for a short gene is
TATGATACCTTGATAGCTATGTGATTG
What is the amino acid sequence of the polypeptide produced according to this DNA information? Use the genetic code chart below and your knowledge of
transcription and translation to figure out the message?

why many students visually perceive stem as a vapid class?

for many students, however, stem subjects are optically discerned as vapid, tedious, and destitute of authentic-world applications. science and math have always been a major part of the high school curriculum, but many students have disengaged from these subjects because they don’t optically discern that they have any pertinence to the authentic world or students’ daily lives. for them, math and science have become a set of rules, procedures, laws, theorems, and formulas to memorize. some students even develop math apprehensiveness and cerebrate they are incapable of learning higher-level mathematics.

why is stem paramount?

as the u.s. economy changes, the ordinant dictation for stem-capable workers is growing. in may of 2014, the u.s. bureau of labor statistics counted more than 8.3 million stem jobs, which accounted for 6.2 percent of total employment in the cumulated states. that number is expected to perpetuate to increment as u.s. companies grow and innovate to compete in the ecumenical economy. according to the u.s. department of labor, the average salary for all stem jobs is $85,570, which is virtually double the average salary for all jobs.

many people still envision stem professionals as wearing a white lab coat and conducting research in a laboratory. in authenticity, some of the most in-demand stem fields are petroleum engineering, process engineering, and computer engineering. these fields that are experiencing shortages of qualified candidates are additionally among the highest paying, with the average petroleum engineer earning an annual salary of $147,520 in may 2014 according to the u.s. bureau of labor statistics.

in additament, stem subjects edify students valuable skills that are vital for prosperity in all vocations, even those that do not directly require stem erudition. engagement in stem subjects avails students develop quandary-solving, critical mentally conceiving, and leadership skills. these skills are so ecumenical, in fact, that statistics relinquished in the summer of 2013 by the u.s. census bureau designated that about three-quarters of the people with a bachelor’s degree in stem fields are not working in those vocations. many non-stem employers are poaching stem-qualified job candidates because they are more ingenious and collaborative than their non-stem counterparts.

as the ecumenical economy perpetuates to evolve, the desideratum for stem-capable workers will perpetuate to grow. by getting edifiers and students involved in the stem kineticism, an incipient generation of adroit workers will be poised to energize and expand this exhilarating field.

check this over.

carbon

explanation:

layer 3 is younger than layer 6.