Biology, 13.07.2019 15:50 rostecorralmart

What type of molecules diffuse through the cell membrane without using a channel protein ?

Answers: 1

Show answers

Another question on Biology

Biology, 22.06.2019 08:00

Which best example best demonstrates the importance of having knowledge of evolutionary relationships? a. illustration of a plant b.organ transplantation between species c. blood donation from a human d. do you need sequence of an insect.

Answers: 1

Answer

Biology, 22.06.2019 08:00

Pls in your opinion, what are the limiting factors that might affect the growth or diversity of our ecosystem? respond to this question in claim, evidence, reasoning format. 1. make your claim (i are the limiting factors that might affect the growth or diversity of our 2. follow the claim with 3 pieces of evidence. evidence may be taken from the reading, the videos, previous lessons, or googled answers. site sources, too. 3. use reasoning to explain why you chose your evidence.

Answers: 3

Answer

Biology, 22.06.2019 11:00

4. if a cell is placed inside a solution that has a higher concentration of solute than on the inside of the cell, what can be said about the movement of water? a. water will move out of the cell, causing it to shrivel. b. water will move in and out of the cell at the same rate. c. water will move out of the cell, causing it to swell. d. water will move into the cell, causing it to swell.

Answers: 2

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?