subject
Biology, 08.05.2021 16:30 Heyitsbrandi

Estas 7 fill in the table below, Name
Modification
Nerve cell
Bean shaped
8. Name three forcer involved in transportastate four adaptations of the alveolus to its functions ​

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 16:20
The mitochondrion functions lipid storage protein synthesis photosynthesis dna replication atp synthesis
Answers: 1
question
Biology, 21.06.2019 23:00
Rue or false siblings look simila rbecause they each have some traits of their parents.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 14:30
Which line in the graph above best illustrates an effect of the carbon dioxide level in the blood on breathing rate before, during and after a period of exercise? 1.b,2.c,3.a,4.d
Answers: 1
You know the right answer?
Estas 7 fill in the table below, Name
Modification
Nerve cell
Bean shaped
8. N...
Questions
question
Mathematics, 15.07.2019 02:30
question
Mathematics, 15.07.2019 02:30
question
Mathematics, 15.07.2019 02:30