Biology, 17.04.2021 03:30 arthurdolz
Complete the sequence of events: (mRNA, protein shape, amino acids, protein structure, DNA, protein function). (Hint, use the first paragraph) __DNA___ β _mRNA β β β β ___protein function
Answers: 1
Biology, 21.06.2019 16:00
Wind energy is plentiful in regions with vast open spaces it is a non polluting renewable resource what could be an economic factor that makes the use of this resource less feasible then non renewable resource even in such regions
Answers: 1
Biology, 22.06.2019 00:00
Darrel conducted an experiment with the following procedure: fill two cups with ice water. place an uninflated balloon snuggly onto your left index finger. blow a little air into an identical balloon, and place it onto your right index finger. place both fingers into the cups of ice water. darrel noticed that his right finger felt warmer in the ice water than did his left finger. which of the following does the experiment show? a. air is a good radiator of heat. b. air is a good insulator of heat. c. air is a good conductor of heat. d. air is a good convector of heat.
Answers: 1
Biology, 22.06.2019 07:00
Explain how sequences of amino acids in proteins can be used to reveal relationships among organisms.
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Complete the sequence of events: (mRNA, protein shape, amino acids, protein structure, DNA, protein...
Mathematics, 01.04.2021 14:50
Mathematics, 01.04.2021 14:50
Mathematics, 01.04.2021 14:50
Chemistry, 01.04.2021 14:50
Mathematics, 01.04.2021 14:50
Mathematics, 01.04.2021 14:50
Geography, 01.04.2021 15:00
Mathematics, 01.04.2021 15:00