subject
Biology, 11.04.2021 23:40 anaikad

Hammed has 200 stamps. 35% from Europe, 10% from Asia , 20% from Australi The rest of the stamps from North America. How many of Hammed's stamps are from North America?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 23:00
Adigestive system that is a series of tubes beginning at the mouth and ending at the anus is a digestive system.
Answers: 1
question
Biology, 22.06.2019 04:00
What amino acid is coded for by this sequence after the mutation
Answers: 1
question
Biology, 22.06.2019 08:00
Drag each tile to the correct box. arrange the layers and faults from oldest to youngest.
Answers: 1
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
You know the right answer?
Hammed has 200 stamps. 35% from Europe, 10% from Asia , 20% from Australi The rest of the stamps fro...
Questions
question
English, 09.04.2021 02:40
question
Mathematics, 09.04.2021 02:40
question
Mathematics, 09.04.2021 02:40