How would this disease most likely impact the grassland ecosystem?
OA.
The vegetation in the...
Biology, 11.12.2020 01:00 tigermath85
How would this disease most likely impact the grassland ecosystem?
OA.
The vegetation in the grasslands will decrease and soil erosion will increase.
ОВ.
The vegetation in the grasslands will increase and soil erosion will increase.
OC.
The vegetation in the grasslands will increase and soil erosion will decrease.
OD.
The vegetation in the grasslands will decrease and soil erosion will decrease.
Answers: 2
Biology, 21.06.2019 21:30
Select the best answer for the question, ly 12. which of the following behaviors is not an inherited behavior?
Answers: 2
Biology, 22.06.2019 09:00
Apuppy’s tendency to chew is inherited through which of the following? a. through learned behavior b.through genes c. through seasonal cycles d. through hibernation
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 12:10
Recombinant dna is the merging of dna from unrelated organisms to create new genetic varieties is assembled in the lab from mononucleotides was part of the green revolution of the 1960s is pollination of one plant by another of the same species is cross-pollination of one plant by a different species
Answers: 1
Mathematics, 03.03.2020 03:23
Computers and Technology, 03.03.2020 03:23
English, 03.03.2020 03:23
Mathematics, 03.03.2020 03:24
History, 03.03.2020 03:24
History, 03.03.2020 03:24
Geography, 03.03.2020 03:24
English, 03.03.2020 03:25