Biology, 18.12.2019 03:31 carlie4charlie

Why is cholesterol important to ur body

Answers: 2

Show answers

Another question on Biology

Biology, 22.06.2019 08:50

If the nucleus of a cell was removed the cell wouldn’t be able to make proteins because

Answers: 1

Answer

Biology, 22.06.2019 11:30

Which organism can most likely be classifild as domain bateria

Answers: 1

Answer

Biology, 22.06.2019 12:20

Which organ controls breathing? lungs alveoli heart diaphragm

Answers: 2

Answer

Biology, 22.06.2019 14:30

The process of meiosis produces only gametes, eggs or sperm. according to the diagram, how many sperm are formed from each cell that undergoes meiosis?

Answers: 1

Answer

You know the right answer?

Why is cholesterol important to ur body...

Questions

Computers and Technology, 28.10.2019 21:31

An allocator move allocated blocks to the end of the heap to maximize throughput. select] select should not should 2. an allocator allocate unaligned...

Mathematics, 28.10.2019 21:31

The percentage of titanium in an alloy used in aerospace castings is measured in 51 randomly selected parts. the sample standard deviation is s = 0.37...

Business, 28.10.2019 21:31

Sold goods costing $1,200 for $2,000 on account. after two weeks the customer returned the goods. there is nothing wrong with the goods; the customer...

Business, 28.10.2019 21:31

Two balloons contain the same amounts of water, sugar, and yeast. two other balloons contain the same amount of water, but have no sugar or yeast. the...

Spanish, 28.10.2019 21:31

2. javier piensa en abrir una compañía exportadora de café. cierto falso 3. el padre de javier tiene conexiones con contadores en barcelona. ci...

Spanish, 28.10.2019 21:31

1- escogermultiple choice activity audio instructionslisten to each question and choose the most logical response. october 18 11: 59 pm 1 attempt rema...

Computers and Technology, 28.10.2019 21:31

Python question: write a program that generates a random number in the range of 1 through 100, and asks the user to guess what the number is. if the...

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

More questions: Biology Another questions