Biology, 28.10.2019 21:31 Skye251

Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode for this mrna? provide the sequence in form (single-or doublestranded) in which it would predominantly appear in the cell. label the termini.
b. draw the result of translation in atomic detail (i. e. chemical structure).
c. how many different mrna sequences could directly* encode for this same translational product? (* disregard non-coding nucleotides.)
d. how many different single nucleotide mutations could be introduced into the directly encoding dna?
e. how many different translational products would result?

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 19:00

What came first egg or chicken? and is tomato a vegetable or a fruit?

Answers: 1

Answer

Biology, 21.06.2019 21:00

What is the answer for the complicated molecules that make up living things usually contain carbon. why is carbon so important in these molecules?

Answers: 3

Answer

Biology, 22.06.2019 02:30

Why would satellite imagery be more useful than a map in some instances? check all that apply. provides landmarks such as buildings is an overhead view of earth’s features can be used when internet is not available provides small details of roads for digital maps provides various methods of transportation to a location

Answers: 1

Answer

Biology, 22.06.2019 05:00

2. if someone had the list of traits you provided in question 1, do you think he or she would be able to find you in a group of 1000 people? why or why not? if not, what other information encoded in your genes might distinguish you from the others in the group? what are other traits that are encoded for by dna?

Answers: 3

Answer

You know the right answer?

Consider the following mrna strand: ccauggcaaaggagugacuaa
a. what dna sequence would encode...

Questions

Biology, 07.11.2020 03:00

Catherine works in a plant nursery and likes all the brightly colored flowers there. She asks the owner about thern and is surprised to learn that al...