subject

Biology, 01.07.2020 16:01 zitterkoph

What disease is caused by this plasmodium which is transmitted through the bite of female mosquito? 2 points CHOLERA B. DENGUE C. MALARIA D. SLEEPING SICKNESS

ansver

Answers: 1

Show answers

Another question on Biology

question

Biology, 22.06.2019 03:00

Select the correct answer from each drop-down menu. during the day, plants produce by splitting water molecules in the light-dependent reactions of photosynthesis. at the same time, plants use cellular respiration to produce some of the needed by the light-independent reactions to make sugars. during the night, plants produce because takes place.

Answers: 1

question

Biology, 22.06.2019 08:10

Match the functions to the cell types ? contraction and relaxation. conducting electrochemical signals fighting diseases carrying genetic material

Answers: 1

question

Biology, 22.06.2019 15:00

Which organelle plays a role in intracellular digestion?

Answers: 1

question

Biology, 22.06.2019 22:20

Identify the product of genetic engineering.

Answers: 3

You know the right answer?

What disease is caused by this plasmodium which is transmitted through the bite of female mosquito?...

Questions

question

Spanish, 04.10.2020 18:01

Read and choose the best words or expressions that connect to the image. A backpack El lápiz La pluma El cuaderno La mochila...

question

Mathematics, 04.10.2020 18:01

Mr. Smith is making $25 and hour before his boss gives him a 10% raise. How much will his new hourly wage be? $25.10 $27.50 $50.00...

question

Chemistry, 04.10.2020 18:01

1s22s22p63s 3p645230104p5 Which element is this? fluorine (F) bromine (Br) chlorine (Cl) krypton (Kr)...

question

Health, 04.10.2020 18:01

WILL GIVE BRAINLIEST IF ANSWERED CORRECTLY Egg shells are permeable and will a. protect the egg from bacteria. b. add many n...

question

English, 04.10.2020 18:01

We lived there for three days - Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination th...

question

Mathematics, 04.10.2020 18:01

The formula for distance traveled dis d = rt, where r is the average speed of the object and t is time traveled. If an object travels 75 meters in 30...

question

History, 04.10.2020 18:01

According to the Population Density map (p. 107), what is the area of greatest population density found in Canada? Select one a. Near Alaska b. Near G...

question

Mathematics, 04.10.2020 18:01

Which rule describes the composition of transformations that maps ΔBCD to ΔB"C"D"? Translation of 5 units x, negative 6 units y composition reflection...

question

Mathematics, 04.10.2020 18:01

Emily bought forty eight crayons that came in packs of 4. How many packs of crayons did dan buy?...

question

Mathematics, 04.10.2020 18:01

Two similar triangles are shown below: Two triangles are shown. The sides of the triangle on the left are marked 6, 4, 3. The sides of the triangle o...

question

Physics, 04.10.2020 18:01

Suppose a force of N is required to stretch and hold a spring m from its equilibrium position. a. Assuming the spring obeys Hooke's law, find the spri...

question

Biology, 04.10.2020 18:01

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...

question

Computers and Technology, 04.10.2020 18:01

The process of determines what volume a system can handle by comparing its performance to standards in the industry....

question

Mathematics, 04.10.2020 18:01

7. There are 1000 different components in the system that your department has just designed. The objective is that for each of the systems that you de...

question

History, 04.10.2020 18:01

Amin 3. How are the New England Colonies alike?...

question

Biology, 04.10.2020 18:01

Who Believed that species could inherit traits that would help them adapt and survive within an environment...

question

Geography, 04.10.2020 18:01

Earth's physical layers in sequence...

question

Mathematics, 04.10.2020 18:01

Given the figure below, find the values of x and z. (14x + 55) (10x + 29)...

question

History, 04.10.2020 18:01

Which amendment protects citizens from being forced to house troops? O the First Amendment O the Third Amendment O the sixth Amendment

question

Chemistry, 04.10.2020 18:01

Which rate describes a unit price? A.$1.00 for 2 lemons B.$3.00 for every pound C.$4.00 for 3 slices of pizza D.$6.00 for every 6 b...

More questions: Biology Another questions