subject
Biology, 04.10.2020 18:01 kayliebug2003

A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?

ansver
Answers: 2

Another question on Biology

question
Biology, 21.06.2019 19:40
The many volcanoes located along the edge of the pacific ocean make up the ring of fire. how does subduction play a role in the volcanic activity in the ring of fire?
Answers: 1
question
Biology, 21.06.2019 21:30
Organisms are classified, or grouped into categories, based on similarities in their characteristics and/or evolutionary relationships. the study of how organisms are classified is known as
Answers: 1
question
Biology, 22.06.2019 13:00
Astudent from one of the research labs is having trouble preparing a slide for examination and photographing. the bacterial slide that he has brought to you was prepared using a commercially purchased stain. he has asked for your in determining what he is doing wrong so that he can change the lab protocols and continue on with his project. after examining the slide under oil immersion, you determine that no bacteria are present even though the student is able to show you the culture he used to make that slide that has visible growth in the liquid medium. which of the following statements does not explain the fact that there are no bacteria present on the student’s slide? by not allowing a glass slide to completely air dry before heat fixation, the flame will cause the surrounding water to boil and this will damage the bacterial cell. overheating during the fixation step boiled the water within the bacterial cells and resulted in the cells bursting. insufficient heating of the slide did not drive out the thin layer of water and this resulted in minimal bonding between the bacteria and the glass slide. rinsing with alcohol during the washing step stripped the bacteria off the glass slide. rinsing with alcohol during the washing step stripped the bacteria off the glass slide.
Answers: 1
question
Biology, 22.06.2019 21:00
Some steps in cell division are shown below: 1. chromosomes condense and pair up 2. segments of dna of sister chromatids twist and cross 3. exchange of dna occurs between chromosomes 4. four daughter cells are created that are haploid which of the following steps is least likely to occur during meiosis 1?
Answers: 1
You know the right answer?
A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?...
Questions
question
Mathematics, 11.09.2019 23:20
question
Mathematics, 11.09.2019 23:30
question
Arts, 11.09.2019 23:30