Biology, 17.02.2020 21:32 ashleyaparicio7116
In familial hypercholesterolemia, individuals homozygous for the allele causing the disorder completely lack receptors on liver cells that take up cholesterol from the blood stream. Heterozygotes have one-half the number of receptors while individuals homozygous for the normal allele are phenotypically normal. This is an example of:
Answers: 2
Biology, 22.06.2019 08:40
What substance acts to prevent sudden ph changes in bodily fluids?
Answers: 2
Biology, 22.06.2019 09:20
Give examples of selective advantage of organism’s body part/organ
Answers: 1
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Biology, 22.06.2019 14:00
Which diagram best represents the chromosomes that would be found in a two new skin cells produced as a result of this process?
Answers: 1
In familial hypercholesterolemia, individuals homozygous for the allele causing the disorder complet...
Mathematics, 04.02.2020 07:03
History, 04.02.2020 07:03
Mathematics, 04.02.2020 07:03
Mathematics, 04.02.2020 07:03
Mathematics, 04.02.2020 07:03
Mathematics, 04.02.2020 07:03
Geography, 04.02.2020 07:03
Physics, 04.02.2020 07:03
History, 04.02.2020 07:03
History, 04.02.2020 07:03
Mathematics, 04.02.2020 07:03