Biology, 11.12.2019 18:31 grayjasmine46
Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the sequence taatacgactcactataggg has a melting temperature (tm) of 59 °c. if an rna duplex oligonucleotide of identical sequence (substituting u for t) is constructed, will its melting temperature be higher or lower?
Answers: 1
Another question on Biology
Biology, 22.06.2019 03:30
Glucose is broken down in different ways, both in the presence and in the absence of oxygen. using the table for reference, what major products are formed in each reaction set?
Answers: 1
Biology, 22.06.2019 09:30
The “ecological footprint” left by a citizen of a developed nation is about four times larger than that left by a citizen of a developing nation. why is this the case?
Answers: 1
Biology, 22.06.2019 14:50
This connective tissue consists of large round densely packed cells with the nucleus pushed to one side.
Answers: 1
Biology, 22.06.2019 17:00
Achemical that is released by an animal as a signal to other members of the same species is called a pheromone. t or f
Answers: 1
You know the right answer?
Denaturation of nucleic acids a duplex dna oligonucleotide in which one of the strands has the seque...
Questions
Mathematics, 01.12.2021 07:10
Mathematics, 01.12.2021 07:10
Mathematics, 01.12.2021 07:20
English, 01.12.2021 07:20
Mathematics, 01.12.2021 07:20
English, 01.12.2021 07:20
Biology, 01.12.2021 07:20
History, 01.12.2021 07:20
