Dna replication, transcription, & translation (10 points)
1. provide the (a) dna strand and (b) mrna strand that would be produce from the
following dna template: gctaccgactcgactgcactt
a. dna strand:
b. mrna strand:
2. what enzyme(s) is adding nucleotides to the template dna strand during (a) dna replication
and (b) transcription
a. dna replication:
b. transcription:
3. use the mrna strand from question 1 to translate into a series of proteins. use the
codon chart attached and fill out the chart below.

cells use diffusion to get substances in and out of themselves. that diffusion will occur across the cell membrane or the outer covering of the cell. because we are talking about the surface of the cell, surface area and volume are  important factors here. as a cell increases in size, its surface area and volume increase as well.  we call that the surface area to volume ratio (sa: vol).  but the catch is that  volume increases at a greater rate than surface  area. in other words, as a cell gets bigger, the sa: vol gets smaller. so a really small cell like bacteria is mostly cell membrane (surface) with very little contents (volume). a really big cell like an egg, is mostly insides with a super thin membrane. so what ends up happening is that the cell cannot efficiently diffuse all of the stuff it needs in/out to survive. therefore cell size is limited to about 100mm. so how do we make organisms bigger than 100mm? cells divide! by dividing and becoming multicellular, organisms are able to grow!   check out the diagrams i attached to see the effect of sa: vol. i hope this ! good luck!

after a the power stroke, adp is released, but the cross-bridge formed is still in place. atp then binds to myosin, moving the myosin to its high-energy state, releasing the myosin head from the actin active site.

it is a. i hope this .

for a different answer set the answer would be because the oxygen in the water had depleted (apex)