subject

Biology, 26.06.2019 01:30 ik457

Is paramecium in the protista kingdom

ansver

Answers: 2

Show answers

Another question on Biology

question

Biology, 21.06.2019 14:00

What heat is removed how does a gas become a liquid

Answers: 2

question

Biology, 22.06.2019 05:30

Plants consume most of their carbon from a. the soil b. the water c. the roots d. the air

Answers: 2

question

Biology, 22.06.2019 08:30

Iwanna go do something with my ideas? ?

Answers: 2

question

Biology, 22.06.2019 13:50

2points what do bacteria have in common with the cells of other living organisms?

Answers: 2

You know the right answer?

Is paramecium in the protista kingdom...

Questions

question

Computers and Technology, 28.10.2019 21:31

Python question: write a program that generates a random number in the range of 1 through 100, and asks the user to guess what the number is. if the...

question

Health, 28.10.2019 21:31

Indicate whether each statement is true or false regarding type 1 and type 2 diabetes mellitus. 1. type 1 diabetes mellitus is also called non-...

question

Business, 28.10.2019 21:31

Molly mocha employs one college student every summer in her coffee shop. the student works the five weekdays and is paid on the following monday. (for...

question

Chemistry, 28.10.2019 21:31

Which has the higher enthalpy under these conditions, 2 o3(g) or 3 o2(g)?...

question

Business, 28.10.2019 21:31

Jill lives in a large metropolitan area. she is thinking about starting a senior citizen van service, where she will pick up seniors from nursing home...

question

Mathematics, 28.10.2019 21:31

Give an example of a quadratic equation with 2 + 3i as one of its solutions...

question

Mathematics, 28.10.2019 21:31

Define: voluntary responsea) every possible sample of a given size has the same chance to be selected. b) using extraneous factors to create similar...

question

Chemistry, 28.10.2019 21:31

Which of these equations represent reactions that could be used in constructing an electrochemical cell? check all that apply....

question

Chemistry, 28.10.2019 21:31

By looking at the uncertainty of the bacterium's position, did the student have a valid point? a. the student has a point. the uncertainty of...

question

Biology, 28.10.2019 21:31

Consider the following mrna strand: ccauggcaaaggagugacuaa a. what dna sequence would encode for this mrna? provide the sequence in form (sing...

question

Biology, 28.10.2019 21:31

What is the main advantage of a sole proprietorship?...

question

Physics, 28.10.2019 21:31

Development of life goals, access to community resources, long-term counseling, and accountability are all examples of case management....

question

Mathematics, 28.10.2019 21:31

Ababy woolly mammoth that was discovered in 2007 died approximately 39,000 years ago. how many c-14 atoms per 1.0 × 108 c-12 atoms would have be...

question

Mathematics, 28.10.2019 21:31

Use the method in the example to find the square roots of 1 + √3i...

question

Business, 28.10.2019 21:31

The term ""insecure laboratory procedures"" in the definition of a biohazard presented in this educational module refers to which element of biohazard...

question

Business, 28.10.2019 21:31

The town of genter recently witnessed a devastating hurricane that crippled the town's infrastructure. q-mart, a retail chain that plans to open a new...

question

Mathematics, 28.10.2019 21:31

Which is an example of gaining a static charge by conduction?...

question

Social Studies, 28.10.2019 21:31

Which general conclusion did issac newton observation of gravity have on the way we understand the universe...

question

Mathematics, 28.10.2019 21:31

Which of the inequalities matches the statement? "a number y, increased by 14 is greater than 22" a)y-14> 22 b)y-14<...

question

Social Studies, 28.10.2019 21:31

What signals the adrenal glands to produce more of the hormones adrenaline and cortisol and release them into the bloodstream?...

More questions: Biology Another questions