Explain several ways water is stored during the water cycle

In a population that is in hardy-weinberg equilibrium, there are two possible alleles for a certain gene, a and a. if the frequency of allele a is 0.4, what fraction of the population is heterozygous? a. 0.40 b. 0.60 c. 0.16 d. 0.48

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

What is the function of the root cap? a. extra-absorbent cells in the root cap absorb more water and nutrients b. protect the meristematic area of the stem c. contains sensors for sunlight d. increases surface area of the root