subject
Spanish, 17.01.2020 11:31 ayyyyy65

What phrase uses subjunctive tense to persuade or influence?

a) quiero que vengas a tiempo.
b) nunca vienes a tiempo.

ansver
Answers: 2
Show answers

Another question on Spanish

question
Spanish, 24.06.2019 02:30
Julia is making plans with her friend, carla. complete her e-mail with the correct verb. ¿tú con nosotros? a. pierdes c. quieres b. tienes d. vienes
Answers: 2
Answer
question
Spanish, 24.06.2019 17:00
Read the question and the sentences, and choose the option with the correct sentence. which of the following has the pronoun correctly used? yo quieres el ceviche. yo quiere el ceviche. yo quiero el ceviche. yo quieren el ceviche.
Answers: 2
Answer
question
Spanish, 25.06.2019 04:30
La profesora los libros a los estudiantes. (1 point) question 8 options: 1) les dan 2) les da 3) les doy 4) nos da
Answers: 2
Answer
question
Spanish, 25.06.2019 08:00
Dole exports piñas, toronjas y bananas de la ceiba. true false
Answers: 2
Answer
You know the right answer?
What phrase uses subjunctive tense to persuade or influence?

a) quiero que vengas a tie...
Questions
question
Mathematics, 10.03.2020 08:08
Consider a sample of rubber bands. Their weights are measured and found to have a variance of 2.57. Give a point estimate for the population variance...
question
Biology, 10.03.2020 08:08
are multiple arteries that fuse in order to serve a single capillary network. are multiple arteries that fuse in order to serve a single capillary ne...
question
Computers and Technology, 10.03.2020 08:08
Question 4. Use simulate_several_key_strikes 1000 times, each time simulating the monkey striking 11 keys. Compute the proportion of times the monkey...
question
Business, 10.03.2020 08:08
Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...
question
Computers and Technology, 10.03.2020 08:08
A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...
question
Physics, 10.03.2020 08:08
An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...
question
Social Studies, 10.03.2020 08:08
Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...
question
Business, 10.03.2020 08:08
An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...
question
Biology, 10.03.2020 08:08
Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...
question
Business, 10.03.2020 08:08
You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...
question
Mathematics, 10.03.2020 08:08
Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...
question
Business, 10.03.2020 08:08
River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...
question
Social Studies, 10.03.2020 08:08
Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...
question
Business, 10.03.2020 08:08
In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...
question
Business, 10.03.2020 08:08
The purpose of is to conceive, analyze, and creatively select channels of communication that will direct advertising messages to the right people in...
question
Physics, 10.03.2020 08:08
In terms of impulse and conservation of momentum, explain why a glass is much more likely to break if it falls onto a cement floor than if it falls on...
question
Business, 10.03.2020 08:08
Unlike manufacturers, buy products from other businesses but do not significantly alter the form of the products they buy before selling them....
question
Biology, 10.03.2020 08:09
C. Which specific biomolecule (lipid, protein, nucleic acid, carbohydrate) is each food mostly made of?...
question
Physics, 10.03.2020 08:10
A mass that weighs 8 lb stretches a spring 6 in. The system is acted on by an external force of 8 sin(8t) lb. If the mass is pulled down 3 in and then...
question
Mathematics, 10.03.2020 08:10
Which best describes how an accretionary wedge forms? Group of answer choices as a result of the accumulation of sediment and oceanic crust being scra...
More questions: Spanish Another questions
See results (0)