subject
Spanish, 03.05.2020 13:42 genyjoannerubiera

Which of the following school items can also be used at the gym, when hiking, for travel, and even for going on a picnic?

una pluma
una mochila
un cuaderno
una goma

ansver
Answers: 3
Show answers

Another question on Spanish

question
Spanish, 22.06.2019 21:50
Need with this match the pronoun with the sentence it belongs to: )
Answers: 2
Answer
question
Spanish, 24.06.2019 10:00
Es aconsejable que ustedes sobre el país donde van a residir. a. aprenda b. aprendamos c. aprendan d. aprendas
Answers: 2
Answer
question
Spanish, 24.06.2019 12:00
¿quienes fueron los primeros en bailar el tango?
Answers: 2
Answer
question
Spanish, 24.06.2019 18:00
The dome of the rock and ai-aqsa mosque are located in what city?
Answers: 1
Answer
You know the right answer?
Which of the following school items can also be used at the gym, when hiking, for travel, and even f...
Questions
question
Mathematics, 04.04.2020 13:59
PLEASE HELP WILL NAME BRAINLIEST...
question
Computers and Technology, 04.04.2020 14:00
Which of the following is true of data collection:. a. Data collection is of secondary importance to computer security. b. Data collection should not...
question
Physics, 04.04.2020 14:00
An air-plane has an effective wing surface area of 17.0 m² that is generating the lift force. In level flight the air speed over the top of the wings...
question
Biology, 04.04.2020 14:00
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymerase proceeds along thi...
question
Chemistry, 04.04.2020 14:00
2.00 moles of an ideal gas was found to occupy a volume of 17.4L at a pressure of 3.00 atm and at a temperature of 45 C. Calulate the value of the cas...
question
Mathematics, 04.04.2020 14:00
A group of n people enter an elevator in a building with k floors. Each person independently selects a floor uniformly at random (each with equal prob...
question
Chemistry, 04.04.2020 14:01
What is likely to be true about the ∆H for this reaction? C6H6 (l) → C6H6 (s) ∆H>0 ∆H=0 ∆H<0...
question
Mathematics, 04.04.2020 14:01
Cole is studying employment trends.He found that 20% of the social workers he surveyed, or 45 social workers,work part time. How many soci...
question
Business, 04.04.2020 14:01
A 12-year bond of a firm in severe financial distress has a coupon rate of 12% and sells for $920. The firm is currently renegotiating the debt, and i...
question
Business, 04.04.2020 14:01
Magic Milling Company has 9% annual coupon bonds that are callable and have 18 years left until maturity. The bonds have a par value of $1,000, and th...
question
Mathematics, 04.04.2020 14:01
He assignment problem is . ANSWER Unselected a specialized form of an optimization model that attempts to assign limited capacity to various demand po...
question
Mathematics, 04.04.2020 14:01
Ashley picked up 15 rocks. 3 igneous, 3 metamorphic, and 9 sedimentary. What is the ratio of sedimentary rocks to the total number of rocks?...
question
Mathematics, 04.04.2020 14:01
Consider quadrilateral BCEF inscribed in circle A. Diagonals EB and CF intersect at point D. Select all the statements that are true about the diagram...
question
Business, 04.04.2020 14:01
Bay City uses the purchases method to account for supplies. At the beginning of the year the city had no supplies on hand. During the year the city pu...
question
Computers and Technology, 04.04.2020 14:01
All but one of the following statements about stored procedures is true. Which one is false? a. They consist of one or more SQL statements. b. They ar...
question
Business, 04.04.2020 14:01
In 2009 the federal excise tax on cigarettes was raised. In response, the CDC noted that "... because low-income groups are more responsive to price i...
question
Physics, 04.04.2020 14:02
Determina la magnitud de la fuerza que se debe aplicar a un sillón cuya masa es de 40 kg para que adquiera una aceleración con magnitud de 3 m/s²...
question
Business, 04.04.2020 14:02
Which of the following statements is false? Marginal cost will equal average total cost when average total cost is at its lowest point. When marginal...
question
Mathematics, 04.04.2020 14:02
B. Interpret the Rsquared value. Does the multiple regression equation help us predict the total golf score much better than we could without knowing...
question
Business, 04.04.2020 14:02
Quality control is best defined as: a. ensuring that the project deliverables or end items would be acceptable to the customer b....
More questions: Spanish Another questions
See results (0)