subject

Physics, 17.09.2019 11:30 rbgrh9465

Imagine that kevin can instantly transport himself between planet x and planet y. which statement could be said about kevin in this situation?

ansver

Answers: 1

Show answers

Another question on Physics

question

Physics, 22.06.2019 00:30

Two vectors are shown. which statement best compares the vectors? vector x has greater magnitude than vector y. vector y has greater magnitude than vector x. the vectors have the same displacement. the vectors have the same direction.

Answers: 1

question

Physics, 22.06.2019 02:00

Write the correct abbreviation for each metric unit

Answers: 1

question

Physics, 22.06.2019 18:40

Smallest intensity of a stimulus that you can detect 50 percent of the time is

Answers: 1

question

Physics, 22.06.2019 19:30

Refrigerant-134a flows through a carnot heat pump cycle at 0.5 kg/s. it is known that the maximum absolute temperature in the cycle is 1.1 times the minimum absolute temperature, and the net power input to the cycle is 2.5 kw. if the refrigerant changes from a saturated vapor to a saturated liquid during the heat rejection process, determine the maximum magnitude of the enthalpy of vaporization for this process in kj/kg (with 3 significant figures).

Answers: 3

You know the right answer?

Imagine that kevin can instantly transport himself between planet x and planet y. which statement co...

Questions

question

Mathematics, 15.04.2020 03:53

QUESTION 1 To what was Douglass referring when he wrote 'From that moment, I understood the pathway from slavery to freedom. It was just what I...

question

Business, 15.04.2020 03:53

A manufacturer of hospital supplies has a uniform annual demand for 320,000 boxes of bandages. It costs $10 to store one box of bandages for one year...

question

Business, 15.04.2020 03:53

Purchase-Related Transactions The Stationery Company purchased merchandise on account from a supplier for $14,500, terms 2/10, n/30. The Stationery Co...

question

Engineering, 15.04.2020 03:53

A household refrigerator that has a power input of 450 W and a COP of 2.5 is to cool five large watermelons, 10 kg each, to 8°C. If the watermelons ar...

question

Mathematics, 15.04.2020 03:53

In 5-card poker, played with standard 52-card deck, 2,598,960 difficult hands are possible. If there are 624 different ways a "four-of-a-kind" can be...

question

Business, 15.04.2020 03:53

Hofstede studied how culture influences consumer behavior. When a Japanese company decides that it will be willing to lose money for twenty years in a...

question

Physics, 15.04.2020 03:53

Even though Alice visits the wishing well frequently and always tosses in a coin for good luck, none of her wishes have come true. As a result, she de...

question

Business, 15.04.2020 03:53

Identify the items as consumer programs or consumer information sources local chambers of commerce consumer reports state cons...

question

English, 15.04.2020 03:53

Kite Runner Quiz Chapters 1-5 1. The novel begins with a flashback. What do you think is its purpose? What do you learn about the narrator? 2. Who is...

question

Computers and Technology, 15.04.2020 03:53

Which of the following is not a true statement? a. Data flow diagrams and flowcharts are difficult to prepare and revise using software packages. b. D...

question

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...

question

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

question

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

question

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

question

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

question

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

question

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

question

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

question

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

More questions: Physics Another questions