subject

Physics, 21.04.2020 01:51 alosnomolina1122

What’s the unit for velocity?

ansver

Answers: 2

Show answers

Another question on Physics

question

Physics, 22.06.2019 08:30

If an astronaut takes an object to the moon the following is true (choose only one). a the mass will change but the weight will be the same. b both the mass and the weight of the object will be the same. c the weight will change but the mass will be the same. d both the mass and the weight of the object will change.

Answers: 1

question

Physics, 22.06.2019 13:30

The two stars in a certain binary star system move in circular orbits. the first star, alpha, has an orbital speed of 36 km/s. the second star, beta, has an orbital speed of 12 km/s. the orbital period is 137 d. a) what is the mass of the star alpha? b) what is the mass of the star beta?

Answers: 1

question

Physics, 22.06.2019 15:50

Decreased sensitivity to an unchanging stimulus is known as

Answers: 3

question

Physics, 22.06.2019 16:30

In a heat engine if 1000 j of heat enters the system and the piston does 500j of work, what is the final internal energy of the system if the inital energy was 2000 j1.write the equation2.list out your known variables 3. plug the numbers into the equations4.solve 5.write your solution statement that includes initial energy and final energy added.

Answers: 3

You know the right answer?

What’s the unit for velocity?...

Questions

question

Biology, 02.08.2019 17:00

Suppose a scientist wanted to know if a particular protein was involved in the process of cell division in human skin cells. how might she test for th...

question

Mathematics, 02.08.2019 17:00

Thx! : ) 1. 148 = 2x + 6(x + 10) - what is the value of x? 2. 6x + 4(-x - 14) = -42 - what is the value of x? 3. -101 = 7x - 4(-3x - 8) - what is t...

question

Mathematics, 02.08.2019 17:00

I’m not sure how to set this equation up. want to donate to a better cause? consider micro-lending. micro-lending is a process where you lend directl...

question

Social Studies, 02.08.2019 17:00

What effect would a british blockade of the mississippi have on the us economy during the war of 1812...

question

Mathematics, 02.08.2019 17:00

Which expression is equivalent to this number? 28 19/100...

question

English, 02.08.2019 17:00

In act 1 , scene 2 of macbeth , what does macbeth do to macdonwald ?...

question

English, 02.08.2019 17:00

There are a few subordinating conjunctions that can also act as prepositions. which of the following can act as both? choose the most correct answer....

question

Mathematics, 02.08.2019 17:00

Answer will mark the total capacity of 6 pitchers and 12 glasses is 21 liters. the capacity of a pitcher is 5 times that of a glass. find the capacit...

question

Social Studies, 02.08.2019 17:00

What did alaska and hawaii have in common in the late 1800s? a) both areas are islands in the pacific ocean. b) both areas were far from most of the...

question

Mathematics, 02.08.2019 17:00

Ineed like now ! simplify the expression : 7y + 3x + 3 - 2y + 6 what is the coefficient of y? what is the constant?...

question

Biology, 02.08.2019 17:00

What are pelvic bones in snakes an example of...

question

Biology, 02.08.2019 17:00

To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctat...

question

English, 02.08.2019 17:00

What is professor moriarty’s relationship with holmes?...

question

Health, 02.08.2019 17:00

Aclient can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thighs b: turned i...

question

Mathematics, 02.08.2019 17:00

30 seconds slower than godfrey's time algebraic expression...

question

Mathematics, 02.08.2019 17:00

Explain how to solve the problem below. in your response, you must analyze the given information, discuss a strategy or plan to solve the problem, det...

question

Mathematics, 02.08.2019 17:00

What is 5 to the second power plus 2 the the fifth power plus 1...

question

Mathematics, 02.08.2019 17:00

What is the nature of the solution set to the following system of equations? 3x − 5y =negative -1 6x − 10y = negative-3 no solutions one solution...

question

Mathematics, 02.08.2019 17:00

In a sale, normal prices are reduced by 10%. natalie bought a pair of shoes for £54. what was the original price of the shoes?...

question

Health, 02.08.2019 17:00

Question 2: a client can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thigh...

More questions: Physics Another questions