Mathematics, 24.01.2022 06:50 neon1393

An item is regularly priced at $17 . It is now priced at a discount of 85% off the regular price. Use the ALEKS calculator to find the price now.

An item is regularly priced at $17 . It is now priced at a discount of 85% off the regular price.

Answers: 3

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 18:50

Which of the following is a function? a.) {(-2, -4/5), (-1,-,,-1)} b.) {(-2,,1/,3/,1)} c.) {(-22)} d.) {(-21)}

Answers: 3

Answer

Mathematics, 21.06.2019 19:00

Abarbecue sold 26 hamburgers and hot dogs. hamburgers sell for $3.50 each and hot dogs sell for $2.00 each. if the barbecue made $70 in sales, determine and state the number of hot dogs sold.

Answers: 1

Answer

Mathematics, 21.06.2019 19:00

What expression is equivalent to log3(x+4)

Answers: 1

Answer

Mathematics, 21.06.2019 20:00

The radius of the earth is two times the radius of the moon. what fraction of the volume of the earth is the volume of the moon?

Answers: 1

Answer

You know the right answer?

An item is regularly priced at $17 . It is now priced at a discount of 85% off the regular price....

Questions

Mathematics, 22.01.2021 04:00

The original cost of a comic book was $3.95. The store markup on the comic book was 20%. What is the store's price for the comic book?...

Mathematics, 22.01.2021 04:00

Sanjeep takes out a $250,000 mortgage. The yearly interest rate on the loan is 5% and the loan is for 25 years. Calculate the total amount of interest...

Mathematics, 22.01.2021 04:00

Which is the standard form of the equation of a parabola with a focus of (8,0) and directrix x = -8? y2 =-8 y2 = 8x y2 = 32x y = -3...

Biology, 22.01.2021 04:00

PLEASE HELP TIMED The host is calculating how many grams of limestone will be washed away by 30 kg of sulfur. He first converted kilograms to grams....

Mathematics, 22.01.2021 04:00

Select the correct answer from each drop-down menu. Joanne purchased a new computer for $1,700. She will need to pay $80 each month, Interest free, t...

Mathematics, 22.01.2021 04:00

Write an equation for a line perpendicular to y=-3x + 1 and passing through the point (6,-2)...

Mathematics, 22.01.2021 04:00

The missing exponent 1,728 =12 (?)...

Mathematics, 22.01.2021 04:00

What value of y would make {(-2, 18), (3, y), (6, 6), (-18, 2), (4, 9)} an inverse variation?...

Mathematics, 22.01.2021 04:00

Sin(x+22.5)=cos(x-16.5) what is the value of x?...

Mathematics, 22.01.2021 04:00

- Think Critically Oxygen-16 and oxygen- 17 are isotopes of oxygen. The numbers 16 and 17 represent their mass numbers, respectively. If...

Mathematics, 22.01.2021 04:00

Find the value of a. Hint: Draw in the altitude. Pls explain your answers. Thanks in Advance!

Mathematics, 22.01.2021 04:00

5 people went to the store. Each bought a candy bar for $1.50 and an orange for x dollars. When they were finished they spent $10.80...

Biology, 22.01.2021 04:00

2 DNA: TTTACGGCCATCAGGCAATACTGG mRNA: Codon: Anitcodon: Amino Acids:...

English, 22.01.2021 04:00

PLS HELP !! WORTH 67 POINTS AND I WILL MARK BRAINLIEST ! THIS IS DUE 11:59PM !! Directions: As you read "The Case Against High School Sports," identi...

Mathematics, 22.01.2021 04:00

7. What type of lines does the system y=3x+2 and 3x-y=-2 form?...

Mathematics, 22.01.2021 04:00

Work out the size of angle A. A 11 cm 9 cm 38° B С...

Mathematics, 22.01.2021 04:00

The hudson family is saving for a family vacation to Disney World. They determine that the trip will cost $3,200. Mr and Mrs. Hudson have already set...

Mathematics, 22.01.2021 04:00

Juan has a summer job delivering newspapers. He is paid $15 per hour and a $10 bonus when he completes his daily route ifh represents the number of h...

Chemistry, 22.01.2021 04:00

When water is pushed out of the way it is said to be....

Mathematics, 22.01.2021 04:00

Help please for 16 points ...

More questions: Mathematics Another questions