Mathematics, 16.05.2021 09:30 duplessistoccara

This is NOT MATH Question but please help. Watch a video on YouTbe called “How Wolves Changed Rivers"
**And answer the following question

1. Why did the "deer" (they are really elk) leave the valleys when the wolves were re-introduced to Yellowstone?

2. When the elk left the valleys, what happened to the vegetation? Give specific examples.

3. Once the vegetation changed, what wildlife came back?

4. How did the wolves change the rivers?

5. How did the elk change the rivers when the wolves were removed from Yellowstone National Park?

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:40

What is the solution of the systems of equations? y=2/3x+3 x=-2

Answers: 2

Answer

Mathematics, 21.06.2019 17:40

The graph of h(x)= |x-10| +6 is shown. on which interval is this graph increasing

Answers: 2

Answer

Mathematics, 21.06.2019 20:30

Kayaks rent for $35 per day. which expression can you use to find the cost in dollars of renting 3 kayaks for a day?

Answers: 1

Answer

Mathematics, 21.06.2019 22:00

You buy 4 items that cost 2.69 14.45 8.05 13.95 what is the estimated total round to the nearest dollar

Answers: 1

Answer

You know the right answer?

This is NOT MATH Question but please help. Watch a video on YouTbe called “How Wolves Changed River...

Questions

Spanish, 04.07.2019 12:30

Where is abraham ahora? with mrs. morningstar hiding with william en el cementerio en el zoológico...

History, 04.07.2019 12:30

Did the civil war end before or after the assassination of abraham lincoln...

Biology, 04.07.2019 12:30

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for theme template strand above. what would the mrna be based upon the template strand a...

Biology, 04.07.2019 12:30

Explain the main difference between organisms of the domains bacteria and archaea and organisms of the domain eukarya....

Spanish, 04.07.2019 12:30

El verbo ser y estar i. complete the story, use the correct form of the verb "ser" or "estar" el juan. el de arizona. juan muy triste. juan perdio...

Business, 04.07.2019 12:30

Afirm has $100 million in revenues. does that mean it has generated a cash flow of $100 milion?...

Mathematics, 04.07.2019 12:30

What are the roots of the equation? 6x^2=18x...

Chemistry, 04.07.2019 12:30

Achange that occurs when a substance changes composition by forming one or more new substances...

Physics, 04.07.2019 12:30

An object has a constant acceleration of 3.2 m/s^2.at a certain instant its velocity is 10 m/s . what is its velocity after 5 sec...

Social Studies, 04.07.2019 12:30

An election held within a political party at which the voters choose candidates who will appear on the ballot in an upcoming general election is a(n)...

English, 04.07.2019 12:30

Hunger games movie what work have they generated/produced in the past?...

Social Studies, 04.07.2019 12:30

Chandra believes that her astrological sign, libra, provides a guide for her daily and weekly actions. she reads her horoscope every morning without f...

Mathematics, 04.07.2019 12:30

What is the slope of y-intercept of this line? y=-6x+2...

Business, 04.07.2019 12:30

If the amount payable in two years is $2420 for a simple loan at 10 percent interest, the loan amount is...

English, 04.07.2019 12:30

Did you know african elephant is an endangered species? a. an b. _ c. the...

Mathematics, 04.07.2019 12:30

K12 3.12 congruence and rigid motions...

Mathematics, 04.07.2019 12:30

What is the completely factored form of f(x)=x3−7x2+2x+4? f(x)=(x−1)(x−(3+13−−√−(3−13−−√)) f(x)=(x+1)(x−(3+13−−√−(3−13−−√)) f(x)=(x+1)(x−(3+52−−√−...

Mathematics, 04.07.2019 12:30

In august to simmons water bill was $48 in september it was 15% lower what was a simmons water bill in september...

English, 04.07.2019 12:30

Be quiet. we to the radio. a. are listening b. listen c. listens...

History, 04.07.2019 12:30

What is the impact that ancient india have on modern days not in india...

More questions: Mathematics Another questions