subject

Mathematics, 25.11.2019 13:31 atlantahead7011

Which of the following is information a basic loan application would not ask you for? a. name b. date of birth c. social security number d. auto insurance agency

ansver

Answers: 3

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 14:10

Abaker makes 186 cookies. some are chocolate chip and some are oatmeal raisin, and both kinds are made with and without nuts, as shown in the table above. because they are more popular, the baker made 2/3 of the cookies chocolate chip. if a chocolate chip cookie is chosen at random, what is the probability that it will have nuts? a) 21/93 b) 21/62 c) 41/93 d) 21/41

Answers: 2

question

Mathematics, 21.06.2019 18:30

1.two more than the quotient of a number and 6 is equal to 7 use the c for the unknown number translate the sentence into an equation

Answers: 1

question

Mathematics, 21.06.2019 21:30

Money off coupons have been circulated to 300 households. only 2/5 of these were redeemed (used) in the local supermarket to get a free shampoo. what fraction of coupons were unused? (ps: write how you got the answer)

Answers: 1

question

Mathematics, 21.06.2019 23:00

Suppose that 15 inches of wire cost 60 cents. at the same rate, how much (in cents) will 12 inches of wire cost

Answers: 2

You know the right answer?

Which of the following is information a basic loan application would not ask you for? a. name b. da...

Questions

question

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

question

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

question

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

question

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

question

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

question

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

question

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

question

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

question

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

question

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

question

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

question

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

question

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

question

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

question

Advanced Placement (AP), 15.04.2020 03:54

Imagine imagining things worthless to spend money on bro Free Points lol...

question

English, 15.04.2020 03:54

Read the following sentences. "Mom, may I please—" "One second, Mia. I just need to finish typing this letter." The purpose of the dash in...

question

Mathematics, 15.04.2020 03:54

The membership of a student group is expressed by the equation y = 14x + 10, where x represents the number of years since the group was fo...

question

Business, 15.04.2020 03:54

The proposition that a company borrows up to the point where the marginal benefit of the interest tax shield derived from increased debt is just equal...

question

Mathematics, 15.04.2020 03:54

A rectangular scoreboard at the football field has an area of 56 square yards. The scoreboard has a height of 4 yards. What is the perimeter of the sc...

question

Mathematics, 15.04.2020 03:54

Given the polynomial f(x)=2x2−2x−3, what is the smallest positive integer a such that the Intermediate Value Theorem guarantees a zero exists between...

More questions: Mathematics Another questions