Mathematics, 18.10.2019 17:00 yzafer3971

Find the quotient 78.5 divided by 10 to the third power

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:00

If i have a 24 in loaf of bread and i cut it into two pieces one 9 in how long was the other

Answers: 2

Answer

Mathematics, 21.06.2019 17:00

Why did the ice arena get so hot after the big game (this is math related google it to find the paper

Answers: 2

Answer

Mathematics, 21.06.2019 19:00

Simplify. (-2)^-3 a. -8 b. -1/8 c. 1/8 d. 8

Answers: 1

Answer

Mathematics, 21.06.2019 19:00

How many real-number solutions does the equation have? -4x^2 + 10x + 6 = 0 a. no solutions b. two solutions c. infinitely many solutions d. one solution

Answers: 2

Answer

You know the right answer?

Find the quotient 78.5 divided by 10 to the third power...

Questions

Mathematics, 03.02.2020 22:46

Which of the following quadrilaterals are classified as types of parallelograms? i. square ii. kite iii. rhombus iv. tr...

Biology, 03.02.2020 22:46

What do lysosomes produce that are essential to their function? a. proteins b. ribosomes c. transport vesicles d. digestive...

Mathematics, 03.02.2020 22:46

If sandy can afford car payments of 350 per month for 7 years, what is the price of a car that she can afford now? assume an interest rate of 10.5 pe...

Biology, 03.02.2020 22:46

Fill in the corresponding mrna sequence of the dna strand: atgcgctgcacgtgcacgtt tacgcgacgtgcacgtgcaa...

Mathematics, 03.02.2020 22:46

Find the difference. 4e4 - 8300 =...

History, 03.02.2020 22:46

In the movie thirteen days, how will a 'sneak attack' be played in the news according to bobby kennedy?...

History, 03.02.2020 22:46

How did president reagan finally resolve the air traffic controllers strike...

Mathematics, 03.02.2020 22:46

Awise man once said "300 reduced by 3 times my age is 99."what is his age?...

Mathematics, 03.02.2020 22:46

Identify the irrational sum(s). select all that apply. + 2.25 + 6 + 10 +...

Business, 03.02.2020 22:46

If a great many data values closer to the left of a data distribution which then tails off to the right the distribution is referred to as?...

Mathematics, 03.02.2020 22:46

Oneed in my math work, but i don’t know how to put a picture to show you...

Social Studies, 03.02.2020 22:46

What kind of exhibits can you see in exical exhibition in córdoba?...

Mathematics, 03.02.2020 22:46

How would u solve this oh and this is middle school math

Mathematics, 03.02.2020 22:46

According to the censusâ€‹ bureau, 64.5% of americans owned their own home in 2013. a local real estate office wants to see if this is the case for it...

Physics, 03.02.2020 22:46

What are scientific units for describing an object that is acclerating...

Biology, 03.02.2020 22:46

Explain why the answer choice is right for both of the questions if you can

Biology, 03.02.2020 22:46

Most amphibians have an aquatic larval form with and a terrestrial adult form with...

History, 03.02.2020 22:46

How did religious and ethnic diversity pose challenges for south asian nations after independence?...

Mathematics, 03.02.2020 22:46

In a geometry class, the students were asked to prove the theory below by contradiction. theorem: a triangle has at the most one obtuse angle....

Mathematics, 03.02.2020 22:46

Find the difference: (6y3 17y − 3) − (4y3 − 11y 9)...

More questions: Mathematics Another questions