subject

Mathematics, 16.04.2021 08:40 kbrook12

If f(x) = 3x +7, find

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 17:30

What is not true about kl and mn? what is mn? (show your work)

Answers: 1

question

Mathematics, 21.06.2019 20:30

The cost for an uberi is $2.50 plus $2.00 mile. if the total for the uber ride was $32.50, how many miles did the customer travel?

Answers: 3

question

Mathematics, 21.06.2019 22:00

If abcde is reflected over the x-axis and then translated 3 units left, what are the new coordinates d? are he re

Answers: 1

question

Mathematics, 21.06.2019 23:30

Katie wants to collect over 100 seashells. she already has 34 seashells in her collection. each day, she finds 12 more seashells on the beach. katie can use fractions of days to find seashells. write an inequality to determine the number of days, dd, it will take katie to collect over 100 seashells.

Answers: 1

You know the right answer?

If f(x) = 3x +7, find...

Questions

question

Biology, 26.01.2021 17:50

Sperm cells are to enable them to egg cells. To do this they need to travel long distances - relative to their size - to reach the , then break throug...

question

Mathematics, 26.01.2021 17:50

Questions 5-8 I'm very confused

question

Computers and Technology, 26.01.2021 17:50

Fill in the blanks to output "We are learning ES6!". let n = 6; let s = ES'; + let msg = We are learning console. log(...

question

Mathematics, 26.01.2021 17:50

What is the perimeter, in inches, of a rectangle whose length is 12 inches and whose area is 96 sq. in.?...

question

Mathematics, 26.01.2021 17:50

Find the measure of DBE: 1450 B 30 60 90 0 1450

question

Physics, 26.01.2021 17:50

While both comets and asteroids are found to orbit the Sun in our Solar System, which choice correctly explains how they are different? Comets are muc...

question

Mathematics, 26.01.2021 17:50

Farmer Joe Crazyhair has 12.4 acres of land. He uses 4.52 acres of land for growing fruits and 6.15 acres of land for growing vegetables. How many acr...

question

English, 26.01.2021 17:50

Why does the evidence provided in the excerpt make the author's argument more effective? It is vague. It is specific. It is complicated. It is scienti...

question

Mathematics, 26.01.2021 17:50

(-Z - 8) - (62-5) Help me please thank...

question

Biology, 26.01.2021 17:50

Explain the following statement "Environmental conditions and individual choices can influence the expression of an organism's inherited traits"...

question

Mathematics, 26.01.2021 17:50

Marcus charges an hourly rate and a set up fee for supplies to do landscaping work in his neighborhood. In May, Marcus completed a job that took 7 ho...

question

Mathematics, 26.01.2021 17:50

Estimate the solution to the system of equations. You can use the interactive graph below to find the solution. y= 4x - 2 y= 2 + 3...

question

English, 26.01.2021 17:50

Anyone is a lesbain ???...

question

Mathematics, 26.01.2021 17:50

What are these two answers, explanation needed ...

question

Mathematics, 26.01.2021 17:50

Of the 800 participants in a marathon , 120 are running to raise money for a cause. How many participants out of 100 are running for a cause?...

question

Mathematics, 26.01.2021 17:50

Help me plz I need this ...

question

Chemistry, 26.01.2021 17:50

How does a covalent bond differ from an ionic bond...

question

Mathematics, 26.01.2021 17:50

Simplify the expression 4(n-3) + 2(-3+n)...

question

English, 26.01.2021 17:50

Can someone help me with this ...

question

Biology, 26.01.2021 17:50

Compare the two DNA strands below to identify the type of mutation that has taken place. DNA strand #1: AACGTTGCGGCCATCGTGCTAATG DNA strand #2:...

More questions: Mathematics Another questions