Mathematics, 01.04.2021 17:40 mrfishyyyy

That is the relationship between the pair of angles ZAXC and _BXC shown in the diagram?
100"
80°
A
B
A. They are supplementary angles,
B. They are right angles,
C. They are vertical angles.
D. They are complementary angles,

That is the relationship between the pair of angles ZAXC and _BXC shown

in the diagram?
100
80°

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:30

Which of the following tables represents exponential functions?

Answers: 1

Answer

Mathematics, 21.06.2019 19:00

Use the quadratic formula to solve the equation. if necessary, round to the nearest hundredth. x^2 - 20 = x a. 5, 4 b. -5, -4 c. -5, 4 d. 5, -4

Answers: 2

Answer

Mathematics, 21.06.2019 19:30

Choose the more precise measurement. 26.4 cm or 8.39 cm

Answers: 1

Answer

Mathematics, 21.06.2019 22:00

Two numbers have a sum of -19. one number is x. what expression represents the other number?

Answers: 2

Answer

You know the right answer?

That is the relationship between the pair of angles ZAXC and _BXC shown in the diagram?
100"<...

Questions

Computers and Technology, 15.04.2020 03:53

Which of the following is not a true statement? a. Data flow diagrams and flowcharts are difficult to prepare and revise using software packages. b. D...

Business, 15.04.2020 03:53

Consider the equation %ΔM + %ΔV ≈ %ΔP + %ΔY. If the velocity of money does not change (%ΔV = 0), and the change in real GDP exactly keeps pace with th...

English, 15.04.2020 03:53

The main idea is usually found after the topic sentence. True False...

Mathematics, 15.04.2020 03:53

What is the approximate area of the figure ?...

Social Studies, 15.04.2020 03:54

Jane enters into a contract with Jill to provide 100 roses for a dinner party. Jill fails to deliver the roses. Jane initiates a suit against Jill, as...

Business, 15.04.2020 03:54

Suppose that when the price of wheat is $2 per bushel, farmers can sell 10 million bushels. When the price of wheat is $3 per bushel, farmers can sell...

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

More questions: Mathematics Another questions

That is the relationship between the pair of angles ZAXC and _BXC shown in the diagram? 100" 80° A B A. They are supplementary angles, B. They are right angles, C. They are vertical angles. D. They are complementary angles,

Answers

Another question on Mathematics

That is the relationship between the pair of angles ZAXC and _BXC shown in the diagram?
100"
80°
A
B
A. They are supplementary angles,
B. They are right angles,
C. They are vertical angles.
D. They are complementary angles,