Mathematics, 08.03.2021 23:10 aspenbaxter201634

Sam didn't have any money but he bought a new toy with his credit card. the toy costs 7$ how much money does he have on his credit card

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 13:00

What is the equation of the graph that represents f(x)=x^4 stretched vertically by 2 and shifted up 3 spaces

Answers: 1

Answer

Mathematics, 21.06.2019 17:30

What values of x satisfy the inequality x^2-9x< 0? how is your answer shown on the graph?

Answers: 2

Answer

Mathematics, 21.06.2019 21:40

Aphrase is shown read the phrase and give me the answer

Answers: 1

Answer

Mathematics, 22.06.2019 01:00

Given that δabc is similar to δdef, which is a possible trigonometric ratio for ∠d? a) tan d = 24 30 b) tan d = 30 24 c) tan d = 18 24 d) tan d = 24 18

Answers: 2

Answer

You know the right answer?

Sam didn't have any money but he bought a new toy with his credit card. the toy costs 7$ how much mo...

Questions

English, 04.07.2019 12:00

The kitchen in my parents house smells like vanilla and cinnamon, how do i diagram this sentence?...

History, 04.07.2019 12:00

Why did colonist wait to declare independence from britain...

Mathematics, 04.07.2019 12:00

Stefan sells jin a bicycle for $114 a for $18. the total cost for jin is 120% of what stefan spent or to buy the bike and helmet. how much did stefan...

English, 04.07.2019 12:00

If you went to a job interview what would be your first impression?...

Chemistry, 04.07.2019 12:00

An electron will drop to a lower energy level when it energy...

Advanced Placement (AP), 04.07.2019 12:00

X=75 is it slope intercept form, point slope form, or standard form?...

Mathematics, 04.07.2019 12:00

Find the inverse of the function h(x) = -2x+5...

French, 04.07.2019 12:00

How many children does the average family in luxembourg have? less than two three none four or more...

Mathematics, 04.07.2019 12:00

Idon’t no what this answer is -2(6x+5)=110...

Mathematics, 04.07.2019 12:00

There are 2140 beads in a set, if using beads that have 7 to make braceletshow many bracelets can be made...

Mathematics, 04.07.2019 12:00

On a math team at the beginning of the year, 3/5 of the kids are girls. the ratio of girls to boys is 3: 2. at the end of the year, 5 girls join the t...

Mathematics, 04.07.2019 12:00

What is the mean of this question i need the answer asap...

Mathematics, 04.07.2019 12:00

There are 745 students going on a school field trip. each bus can carry 46 students. how many buses should the school reserve? explain your reasoning...

Biology, 04.07.2019 12:00

5’atgcccgggtgtcgtagttga3’ complete the complementary sequence for the template strand....

Mathematics, 04.07.2019 12:00

Polynomial with degree of 3 and zeros 2, -5, 0...

Mathematics, 04.07.2019 12:00

Samson uses 6 gallons of water on 20 plants in his garden. at that rate, how much water will it take to water 30 plants?...

Social Studies, 04.07.2019 12:00

Which country is labeled with the letter "c"? ...

Biology, 04.07.2019 12:00

What words are missing from the diagram 1.a, chlorophyll; b, water 2.a, nadph; b, sunlight 3. a, chlorophyll; b, atp 4. a, oxygen; b, atp

Mathematics, 04.07.2019 12:00

Solve the proportion 7.375meters. = xmeters. 1.475seconds. 1second show your work...

Biology, 04.07.2019 12:00

Language is dependent on what and it thus a product of the limbic system as well?...

More questions: Mathematics Another questions