Mathematics, 05.03.2021 20:40 espinosajoselyn

BRAINLIEST + 10 PTS You roll two dice. Which sums have a 1/12 chance of being rolled.

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 14:00

Roger and natalie travel in similar cars. roger's car drives the two miles to school in 7.5 minutes. natalie drives the same distance in the opposite direction but in only 6.5 minutes. what is true of their velocities?

Answers: 1

Answer

Mathematics, 22.06.2019 00:30

Will mark ! (10 points also! ) if x varies inversely with y and x =6 when equals y= 10, find y when x=8 a. y=4.8 b. y=7.5 c. y=40/3 d. y=4/15

Answers: 1

Answer

Mathematics, 22.06.2019 03:00

For the following equations, find the ratio of a to b. be sure to show all of your work. a. 3a = 6b b. 15a = 5b

Answers: 2

Answer

Mathematics, 22.06.2019 03:00

Benjamin believes that ¼ % is equivalent to 25%. is he correct? why or why not?

Answers: 1

Answer

You know the right answer?

BRAINLIEST + 10 PTS You roll two dice. Which sums have a 1/12 chance of being rolled....

Questions

Biology, 15.04.2020 03:54

Multicellular organisms evolved from three different ancestral lineages: stramenopiles, unikonts, and archaeplastids. Of these, fungi and animals evol...

Physics, 15.04.2020 03:54

The plates of a parallel-plate capacitor are 2.50 mm apart, and each carries a charge of magnitude 77.0 nC. The plates are in vacuum. The electric fie...

Business, 15.04.2020 03:54

Which of the following reasons for diversification is MOST likely to increase the firm's value? a. Increasing managerial compensation b....

Biology, 15.04.2020 03:54

You perform Sanger sequencing on a small fragment of the human genome and obtain the following small sequence read: 5' AGGCTTAAGCTTAATCGGGCTAT 3'. In...

Mathematics, 15.04.2020 03:54

A newly constructed fish pond contains 1000 liters of water. Unfortunately, the pond has been contaminated with 5 kg of a toxic chemical during the co...

Mathematics, 15.04.2020 03:54

1. Write the polynomial in standard form. Identify the degree and leading coefficient of the polynomial. $-3p^3+5p^6-4$ The polynomial i...

Mathematics, 15.04.2020 03:54

Mitch wants to buy a camera. The sale price is $291. What was the original price? 25% off original price....

Computers and Technology, 15.04.2020 03:54

We have the following functional dependencies: course_no, student_id -> grade course_no -> course_name We have the followin...

Physics, 15.04.2020 03:54

A man unloads a 4.0-kg box from a moving van by giving it an initial speed of 1.1 m/s down a ramp that makes an angle of 18° with the horizontal. It s...

Business, 15.04.2020 03:54

One reason new products fail is that although most major corporations use a formal decision-making process, sometimes they fail to critically evaluate...

Health, 15.04.2020 03:54

Max is a seven-month-old baby who was abandoned at an orphanage. He does not get enough nutrition and has not put on any weight in the last few months...

Business, 15.04.2020 03:54

A large retail organization previously divided work among its four employee-benefitsstaff into distinct specializations. One person answered all quest...

Mathematics, 15.04.2020 03:54

Engineers want to design seats in commercial aircraft so that they are wide enough to fit 99 % of all males. (Accommodating 100% of males would requir...

Medicine, 15.04.2020 03:54

Tuberculosis is a serious bacteria infection. If you become infected with tuberculosis you will?...

History, 15.04.2020 03:54

The image on the right shows Mary Vecchio reacting to a student who had been shot by antiwar protestors antiwar officials the...

Advanced Placement (AP), 15.04.2020 03:54

Imagine imagining things worthless to spend money on bro Free Points lol...

English, 15.04.2020 03:54

Read the following sentences. "Mom, may I please—" "One second, Mia. I just need to finish typing this letter." The purpose of the dash in...

Mathematics, 15.04.2020 03:54

The membership of a student group is expressed by the equation y = 14x + 10, where x represents the number of years since the group was fo...

Business, 15.04.2020 03:54

The proposition that a company borrows up to the point where the marginal benefit of the interest tax shield derived from increased debt is just equal...

Mathematics, 15.04.2020 03:54

A rectangular scoreboard at the football field has an area of 56 square yards. The scoreboard has a height of 4 yards. What is the perimeter of the sc...

More questions: Mathematics Another questions