Mathematics, 20.01.2021 22:40 spearjj

is searching online for airline tickets. Two weeks ago, the cost to fly from to was $210. Now the cost is $345. What is the percent increase? What would be the percent increase if the airline charges an additional $50 baggage fee with the new ticket price?

Answers: 2

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 17:30

Subscriptions to a popular fashion magazine have gone down by a consistent percentage each year and can be modeled by the function y = 42,000(0.96)t. what does the value 42,000 represent in the function?

Answers: 2

Answer

Mathematics, 21.06.2019 18:30

Write the slope-intercept form of the line that passes through the point (1, 0) and is parallel to x - y = 7. t

Answers: 2

Answer

Mathematics, 21.06.2019 19:00

Find the equation of the line with slope =8 and passing through (6,53) write your equation in the form y=mx+b

Answers: 1

Answer

Mathematics, 21.06.2019 21:00

Joanie watched 1 out of three of a movie in the morning

Answers: 1

Answer

You know the right answer?

is searching online for airline tickets. Two weeks ago, the cost to fly from to was $210. Now the co...

Questions

Mathematics, 19.10.2020 08:01

At an archeological site, the remains of two ancient step pyramids are congruent. If ABCD~=EFGH, find AD (Diagrams are not to scale) AD=...

Mathematics, 19.10.2020 08:01

ABCD is a parallelogram such that ∠A=(3x - 10)°, ∠C= (x + 80)°and ∠D = (y + 25)°. Find the values of x and y. ILL MARK ANYONE WHO GIVES...

Advanced Placement (AP), 19.10.2020 08:01

In the book behind closed doors. How does Jack plan to explain Millie and Grace's absence once he begins his torture?...

Mathematics, 19.10.2020 08:01

The sum of two numbers is seven. The sum of the squares of the two numbers is twenty-nine. Find the two numbers....

Mathematics, 19.10.2020 08:01

Please I need some answers ...

Mathematics, 19.10.2020 08:01

5) Which angle forms a linear pair with 7)Which angle forms a pair of vertical angles with

Arts, 19.10.2020 08:01

Where did the woman go if they were overwhelmed in Pompey’s Theatre?...

Mathematics, 19.10.2020 08:01

Write an equation of the parabola that passes throigh the points (-2,7), (1,10), and (2,27)...

Mathematics, 19.10.2020 08:01

Solve for x, picture below 30-60-90 triangle ...

Biology, 19.10.2020 08:01

On a corpse, there are beetles and mites, but no flies, ants, or larvae. Which is the correct postmortem interval? 8 days 4 days 1...

Mathematics, 19.10.2020 08:01

Yahtzee is a classic dice game played with 5 dice. Each player's turn consists of rolling the dice up to 3 times in hope of making 1 of 13 categorie...

History, 19.10.2020 08:01

Question 3: What was the importance of international economics (trade and commerce) on the emergence of the colonies in the Americas. Be sure to expla...

Physics, 19.10.2020 08:01

Give two important reasons to do a rough sketch of the crime scene?...

Mathematics, 19.10.2020 08:01

14) Which of the following correctly shows the markings for a perpendicular bisector?

Biology, 19.10.2020 08:01

Hep pl In an mRNA sequence in the following order:CGUAUGGGCUUACUAGUCUAACA: What is the first anticodon to enter the P position?B. W...

Physics, 19.10.2020 09:01

Are the most efficient detector of light...

Mathematics, 19.10.2020 09:01

4+7x=-10+5x please answer...

Mathematics, 19.10.2020 09:01

PLEASE HELP ASAP!Reasoning The numbers 1.333... and 1.444... are both rational numbers. Which of the following is an irrational number that is betwee...

Mathematics, 19.10.2020 09:01

Write an expression to represent the area of the rectangle below in simplest form.

Mathematics, 19.10.2020 09:01

Just complete h, i, j, k, L pleaseee I'll brainlist (don't forget working out)

More questions: Mathematics Another questions