Mathematics, 29.08.2020 01:01 isaiahjohnson2594

Mrs. Phillips ordered 56 sub sandwiches for a team meal, and 2/7 of them were ham. how many of the sandwiches were ham?

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 16:40

Ajar contains a mixture of 20 black marbles, 16 red marbles, and 4 white marbles, all the same size. find the probability of drawing a white or red marble on the first draw. 125 12 01 next question ask for turn it in

Answers: 2

Answer

Mathematics, 21.06.2019 18:00

What is the difference between the predicted value and the actual value

Answers: 1

Answer

Mathematics, 21.06.2019 18:30

Find the area of the regular hexagon if a side is 20 cm.

Answers: 2

Answer

Mathematics, 21.06.2019 20:50

In the diagram, gef and hef are congruent. what is the value of x

Answers: 1

Answer

You know the right answer?

Mrs. Phillips ordered 56 sub sandwiches for a team meal, and 2/7 of them were ham. how many of the s...

Questions

Mathematics, 06.12.2021 09:50

Suppose that the number of cars manufactured at an automobile plant varies jointly as the number of workers and the time they work. If 220 workers can...

Biology, 06.12.2021 09:50

If you were given a cylindrical structure cut from part of a plant, how could you tell whether it was a piece of stem or a piece of root:...

English, 06.12.2021 09:50

Pre-Reading White Man's Burden 1b. Why was White Man's Burden written? 1c. Why might the White Man's Burden be an important historical d...

Biology, 06.12.2021 09:50

Any girl little stressed out of assignment after long day wanna have little fun before going to bed? So if you down?...

English, 06.12.2021 09:50

Just getting boredtell me a joke anyone herefrm following...

English, 06.12.2021 09:50

Select the closing paragraph that is more effective, satisfying readers and summarizing the main idea, 5 As we have seen, there is a gre...

Arts, 06.12.2021 09:50

Bret had always hoped to live on the seashore? What is the phrase? What type of phrase?...

English, 06.12.2021 09:50

Anyone is on-line Here??Getting s bored...

Biology, 06.12.2021 09:50

Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACGCGCTTACGTCTGATCGCT 5' Type of mutation ( 3pts):

History, 06.12.2021 09:50

GOOD AFTERNOON ALL. . ....

Mathematics, 06.12.2021 09:50

The world’s two highest dams are both in Tajikistan. The Rogun dam is 35 meters taller than the Nurek dam. Together they are 635 meters tall. Find the...

Geography, 06.12.2021 09:50

Describe the Natural topography in Northern region?...

Mathematics, 06.12.2021 09:50

N 70 5.4 4.8 P Using trig to ding angles...

World Languages, 06.12.2021 09:50

Ilang step ang kaliangan pag uuwi kana?...

Biology, 06.12.2021 09:50

Mathematics, 06.12.2021 09:50

460,451,442,... Find the 37th term. Find the 37th term....

Arts, 06.12.2021 09:50

Based on the evidence, the officer was ready to make an arrest. What is the phrase? What type of phrase is it?...

History, 06.12.2021 09:50

In what way is this woman helping in the way effort?

Physics, 06.12.2021 09:50

If a thief jumps from the third floor of a house while holding a 10 kg box on his head, the box will feel like it weighs 50 N during the fall....

English, 06.12.2021 09:50

More questions: Mathematics Another questions