subject
Mathematics, 31.01.2020 08:45 lucy143

Acube which measures 27 inches on one side

what is the area of the base?
what is the height?
what is the volume?

ansver
Answers: 1
Show answers

Another question on Mathematics

question
Mathematics, 21.06.2019 16:30
Rectangle pqrs has length a and width 4b. the x-axis bisects ps and qr what are the coordinates of the vertices
Answers: 2
Answer
question
Mathematics, 21.06.2019 19:40
F(x) = 1/x g(x)=x-4 can you evaluate (g*f)(0) ? why or why not?
Answers: 1
Answer
question
Mathematics, 21.06.2019 21:00
George is putting trim around his rectangular deck, including the gate. he will need 44 feet of trim to do the entire deck. if the deck is 13 feet long, how wide is the deck?
Answers: 2
Answer
question
Mathematics, 21.06.2019 23:00
What is the circumference of the pie
Answers: 2
Answer
You know the right answer?
Acube which measures 27 inches on one side

what is the area of the base?
what is...
Questions
question
Mathematics, 24.06.2021 18:40
The question is in the picture below. Will give 20 points each for answering. Pls give a good answer with an explanation.
question
Biology, 24.06.2021 18:40
The next question Oxygen Content of Blood in the Differvat Vessels of the Circulatory System (W) 20 (X) (Y (Z)
question
Mathematics, 24.06.2021 18:40
Math Gestion 10 of 10 An office uses paper drinking cups in the shape of a cone, with dimensions as shown. To the nearest tenth of a cubic inch, what...
question
Mathematics, 24.06.2021 18:40
What is the volume of a cylinder with a base radius of 10 units and a height of 9 units?...
question
Physics, 24.06.2021 18:40
You attend a concert and have a seat that is 70 m away from the stage where the sound is produced. How long does it take for the sound to reach your e...
question
Computers and Technology, 24.06.2021 18:50
Assuming that a guest sends a request to a hotel desk for room reservation, draw a context diagram. Also consider the restaurant and hotel management...
question
Mathematics, 24.06.2021 18:50
2x+ 4y =16 -2x- 3y = -6 solve this system of equations using the elimination method...
question
Business, 24.06.2021 18:50
Hi this is a test question sorry everyone I'm confused...
question
Mathematics, 24.06.2021 18:50
Select the correct answer from each drop-down menu. Use the given functions represented by the equation and the graph to complete the statements.
question
English, 24.06.2021 18:50
Which is the best revision of this sentence using academic vocabulary...
question
Mathematics, 24.06.2021 18:50
A bar of lead is in the shape of a rectangular prism 2 cm by 3 cm by 4 cm. The density of lead is 11.34 grams per cubic centimeter. Find the ma...
question
English, 24.06.2021 18:50
Well, good for you, you look happy and healthy, not me If you ever cared to ask Good for you, you're doin' great out there without me, baby
question
English, 24.06.2021 18:50
Read the statement below then decide whether you agree or disagree with it. Be prepared to support your opinion with details from the article. Here's...
question
Biology, 24.06.2021 18:50
Within a plant, water (H2O) and carbon dioxide (CO2) can be combined (using the energy of sunlight) to produce glucose (C6H12O6) and oxygen (O2). If y...
question
Biology, 24.06.2021 18:50
Witch characteristics do Jupiter and Saturn share...
question
Social Studies, 24.06.2021 18:50
The struggle for equal rights is still ongoing. Minorities face many struggles in acquiring social, political, and economic equality. While de jure di...
question
Biology, 24.06.2021 18:50
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGC...
question
Social Studies, 24.06.2021 18:50
Whats the song with gunna that be like"desingner head to toe sip to the head to flow"​...
question
Chemistry, 24.06.2021 18:50
Observe the movement of the neon molecules in the chamber. Then, one at a time, select argon, oxygen, and water, and observe the movement of the atoms...
question
Business, 24.06.2021 18:50
Suppose that there is no third-party payer in the medical care market in Uganda in 1955. Suppose that in 1960, health insurance companies begin operat...
More questions: Mathematics Another questions
See results (0)