Mathematics, 01.07.2019 16:00 medellincolombia99

The quotient of a number x and the sum of 3 and 7. x is 20.

Answers: 1

Show answers

Another question on Mathematics

Mathematics, 21.06.2019 21:30

If value of cos330° is √3/2 then find tan165°.

Answers: 1

Answer

Mathematics, 21.06.2019 22:30

Assume that y varies inversely with x. if y=1.6 when x=0.5 find x when y=3.2 acellus answer

Answers: 2

Answer

Mathematics, 22.06.2019 02:30

What is the simplified form of 400x100 ? o 200x10 o 200x50 0 20x10 • 20x50

Answers: 1

Answer

Mathematics, 22.06.2019 02:30

F(x) = x^2+x-2/x^2-3x-4 what is the domain and range, x-and y-intercepts, horizontal asymptotes, and vertical asymptotes?

Answers: 3

Answer

You know the right answer?

The quotient of a number x and the sum of 3 and 7. x is 20....

Questions

Mathematics, 22.01.2021 04:00

Can someone help plz im giving brain ...

English, 22.01.2021 04:00

Describe how the use of voice helps develop the mood of The Diary of a Young Girl. Now that you have had a chance to read excerpts from Anne Frank’s...

English, 22.01.2021 04:00

Read the letter to the editor “I, Too, Have a Dream.” How does the writer use structure and language to persuade her readers and support her feelings...

Biology, 22.01.2021 04:00

The is the site where lipids, triglycerides, and steroids are synthesized, as well as where calcium is stored within the cell. The is the site where...

Biology, 22.01.2021 04:00

Scientists have found that the fungus Penicillium brefeldianum produces a toxin known as Brefeldin A (BFA), which is able to block transport from the...

Mathematics, 22.01.2021 04:00

Select all angles adjacent to 24. You must select all correct answers. A. 1 B. 2 C. 3 D. 4

Chemistry, 22.01.2021 04:00

1. While in outer space a rocket engine is able to produce thrust on a spacecraft. Identify the correct action-reaction pair which allows the spacecr...

Mathematics, 22.01.2021 04:00

Help with #12 please ...

Mathematics, 22.01.2021 04:00

The slope of the line shown in the graph is? And the y-intercept of the line is?

History, 22.01.2021 04:00

12. One reason California achieved statehood earlier than other territories in the American Southwest was...

Mathematics, 22.01.2021 04:00

A wire is bent to form four semicircles. How long is the wire to the nearest hundredth?

English, 22.01.2021 04:00

An important character is called A. a major character. B. a minor character. C. a round character....

Biology, 22.01.2021 04:00

DNA: GTACGCGTATACCGACATTC mRNA: Codon: Anitcodon: Amino Acids:...

History, 22.01.2021 04:00

How do you think the world would be different today if Spain had successfully invaded and conquered England in 1588?...

Mathematics, 22.01.2021 04:00

It rained 1.01 inches, but 0.018 of the rain evaporated, how much rain would be left?...

Arts, 22.01.2021 04:00

How do I make Artist statement unique?...

Mathematics, 22.01.2021 04:00

What is the value of x? ...

Mathematics, 22.01.2021 04:00

Select the correct answer from the drop-down menu. (18)-2 Consider the expression (3y)2.-5. The equivalent simplified form of this expres...

English, 22.01.2021 04:00

I will give 33 points plus the other ones that are the same are 60 In the mocking bird Chapter 1, Scout presents much of what she “knows" about Boo R...

Mathematics, 22.01.2021 04:00

I need help solving this please ...

More questions: Mathematics Another questions