subject

Mathematics, 03.07.2019 09:00 cocoarockford

Aright pyramid has a square base with a side length of 8 units. the volume of the pyramid is 128 cubic units. which solid is congruent to the described pyramid?

ansver

Answers: 1

Show answers

Another question on Mathematics

question

Mathematics, 21.06.2019 20:30

Sketch the region enclosed by the given curves. decide whether to integrate with respect to x or y. draw a typical approximating rectangle and label its height and width. y= 5x, y=7x^2then find the area s of the region.

Answers: 3

question

Mathematics, 21.06.2019 21:30

Jalen charges $25.50 for every 3 hours of yard work he does for his neighbors. ralph charges $34 for every 4 hours of work that he does. who charges less? opinions: 1.they charge the same amount 2.jalen 3.ralph

Answers: 1

question

Mathematics, 21.06.2019 21:30

What is the solution to this system of equations? y= 2x - 3.5 x - 2y = -14

Answers: 2

question

Mathematics, 21.06.2019 22:00

Problem situation: caren is making rice and beans. she can spend no more than $10 on ingredients. she buys one bag of rice for $4.99. beans cost $0.74 per pound. how many pounds of beans, x, can she buy? inequality that represents this situation: 10≥4.99+0.74x drag each number to show if it is a solution to both the inequality and the problem situation, to the inequality only, or if it is not a solution.

Answers: 1

You know the right answer?

Aright pyramid has a square base with a side length of 8 units. the volume of the pyramid is 128 cub...

Questions

question

Biology, 10.03.2020 08:08

One reason that the farmer could not mate these cloned sheep with eachother to increase the size of his flock...

question

Business, 10.03.2020 08:08

Assume that a U. S. firm can invest funds for one year in the United States at 12 percent or invest funds in Mexico at 14 percent. The spot rate of th...

question

Computers and Technology, 10.03.2020 08:08

Ralph, the manager of a busy hardware store, knows that he needs to entrust many of his tasks to managers and other employees. is this process of ass...

question

Mathematics, 10.03.2020 08:08

We have three types of birds at three prices: The large bird costs 3 coins, the middle sized bird costs 2 coins and four chicks cost 1 coin. Find the...

question

Health, 10.03.2020 08:08

The cross bridge cycle is a series of molecular events that occur after excitation of the sarcolemma. What is a cross bridge? View Available Hint(s) T...

question

Biology, 10.03.2020 08:08

The structure of the spinal cord can be described as (1) composed of thirty-one segments (2) having a cervical enlargement, lumbar enlargement, and tw...

question

Business, 10.03.2020 08:08

On September 1, Year 1, Orville Corporation has unrestricted Retained Earnings of $8,300,000, Appropriated Retained Earnings of $5,300,000, Cash of $9...

question

Mathematics, 10.03.2020 08:08

Men have head breadths that are normally distributed with a mean of 6.0 inches and a standard deviation of 1.0 inch. Engineers must consider the bread...

question

Mathematics, 10.03.2020 08:08

Consider a sample of rubber bands. Their weights are measured and found to have a variance of 2.57. Give a point estimate for the population variance...

question

Biology, 10.03.2020 08:08

are multiple arteries that fuse in order to serve a single capillary network. are multiple arteries that fuse in order to serve a single capillary ne...

question

Computers and Technology, 10.03.2020 08:08

Question 4. Use simulate_several_key_strikes 1000 times, each time simulating the monkey striking 11 keys. Compute the proportion of times the monkey...

question

Business, 10.03.2020 08:08

Given the following term structure of risk-free interest rates today, what would you expect the interest rate to be on a two year bond three years fro...

question

Computers and Technology, 10.03.2020 08:08

A(n) is a calculation (using encryption technologies) based on the contents of a disk or file. They are engineered so that even small changes in the...

question

Physics, 10.03.2020 08:08

An airplane speeds down a runway lined by red and green lights as it prepares for takeoff. In the distance, the parallel red and green lights appear t...

question

Social Studies, 10.03.2020 08:08

Many different approaches have been suggested to aid the analyst in identifying a set of candidate objects for the structural model. The four most com...

question

Business, 10.03.2020 08:08

An angry customer has emailed Kurtis wanting to know why the custom luggage he ordered three weeks ago hasn't arrived yet. When Kurtis looks up the or...

question

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

question

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

question

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

question

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

More questions: Mathematics Another questions