subject

History, 20.09.2019 09:30 stina2021

When a country is not at war or engaged in hostilities, it is said to be at
- rest
- armistice
- conflict
- peace

ansver

Answers: 1

Show answers

Another question on History

question

History, 21.06.2019 19:30

Even though both ww1 and ww2 were in many ways the same conflict with basically the same countries facing off against each other, the way each war started was significantly different. the question is how what were the differences on how they started

Answers: 1

question

History, 22.06.2019 01:00

The soviet union and the united states believed in two very different economic systems. what were the names of each?

Answers: 1

question

History, 22.06.2019 07:00

In 1991, which of the following split into 15 independent republics when its communist government lost power? a) china b) belarus c) germany d) soviet union

Answers: 2

question

History, 22.06.2019 09:00

Brainliestttme : )) -why do people commit acts of terrorism?

Answers: 1

You know the right answer?

When a country is not at war or engaged in hostilities, it is said to be at
- rest
- ar...

Questions

question

Mathematics, 02.08.2019 17:00

Answer will mark the total capacity of 6 pitchers and 12 glasses is 21 liters. the capacity of a pitcher is 5 times that of a glass. find the capacit...

question

Social Studies, 02.08.2019 17:00

What did alaska and hawaii have in common in the late 1800s? a) both areas are islands in the pacific ocean. b) both areas were far from most of the...

question

Mathematics, 02.08.2019 17:00

Ineed like now ! simplify the expression : 7y + 3x + 3 - 2y + 6 what is the coefficient of y? what is the constant?...

question

Biology, 02.08.2019 17:00

What are pelvic bones in snakes an example of...

question

Biology, 02.08.2019 17:00

To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctat...

question

English, 02.08.2019 17:00

What is professor moriarty’s relationship with holmes?...

question

Health, 02.08.2019 17:00

Aclient can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thighs b: turned i...

question

Mathematics, 02.08.2019 17:00

30 seconds slower than godfrey's time algebraic expression...

question

Mathematics, 02.08.2019 17:00

Explain how to solve the problem below. in your response, you must analyze the given information, discuss a strategy or plan to solve the problem, det...

question

Mathematics, 02.08.2019 17:00

What is 5 to the second power plus 2 the the fifth power plus 1...

question

Mathematics, 02.08.2019 17:00

What is the nature of the solution set to the following system of equations? 3x − 5y =negative -1 6x − 10y = negative-3 no solutions one solution...

question

Mathematics, 02.08.2019 17:00

In a sale, normal prices are reduced by 10%. natalie bought a pair of shoes for £54. what was the original price of the shoes?...

question

Health, 02.08.2019 17:00

Question 2: a client can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thigh...

question

English, 02.08.2019 17:00

This is a point of view where the author uses pronouns like he and she in telling a story....

question

Mathematics, 02.08.2019 17:00

Avirus is spreading exponentially. the initial amount of people infected is 40 and it is increasing at a rate of 5% per day. how many people will be i...

question

History, 02.08.2019 17:00

Why were many americans interested in remaining isolationist?...

question

Mathematics, 02.08.2019 17:00

One fourth the amount of salt. algebraic expression...

question

Chemistry, 02.08.2019 17:00

Which greenhouse gas is emitted when people burn fossil fuels for energy? a)nitrogen b)oxygen c)carbon dioxide d)helium...

question

Physics, 02.08.2019 17:00

Aman weighing 48 newtons climbs a 2.0 m ladder how much work is done a) 0.0 j b) 24 j c) 96 j d) 124 j...

question

Mathematics, 02.08.2019 17:00

The weight of a rock sample is measured to be 2.5 pounds. what is the percent of error in the measurement?...

More questions: History Another questions