History, 16.07.2019 09:50 danielapenaoypgns

How was athens governed under pericles

Answers: 2

Show answers

Another question on History

History, 21.06.2019 20:30

Explain the importance of president harry truman's order to integrate the u.s. military and the federal government.

Answers: 1

Answer

History, 21.06.2019 22:50

Between 1870 and 1916, approximately how many immigrants came to the united states? 10 million 25 million 75 million 125 million

Answers: 2

Answer

History, 21.06.2019 23:40

Principles of cultural identity have been used to justify conflict. true false

Answers: 2

Answer

History, 22.06.2019 00:00

Meaning “restructuring,” reduced government control and the soviet union move away from a totalitarian government. a) glasnost b) detente c) perestroike d) democracy

Answers: 1

Answer

You know the right answer?

How was athens governed under pericles...

Questions

Biology, 02.08.2019 17:00

Suppose a scientist wanted to know if a particular protein was involved in the process of cell division in human skin cells. how might she test for th...

Mathematics, 02.08.2019 17:00

Thx! : ) 1. 148 = 2x + 6(x + 10) - what is the value of x? 2. 6x + 4(-x - 14) = -42 - what is the value of x? 3. -101 = 7x - 4(-3x - 8) - what is t...

Mathematics, 02.08.2019 17:00

I’m not sure how to set this equation up. want to donate to a better cause? consider micro-lending. micro-lending is a process where you lend directl...

Social Studies, 02.08.2019 17:00

What effect would a british blockade of the mississippi have on the us economy during the war of 1812...

Mathematics, 02.08.2019 17:00

Which expression is equivalent to this number? 28 19/100...

English, 02.08.2019 17:00

In act 1 , scene 2 of macbeth , what does macbeth do to macdonwald ?...

English, 02.08.2019 17:00

There are a few subordinating conjunctions that can also act as prepositions. which of the following can act as both? choose the most correct answer....

Mathematics, 02.08.2019 17:00

Answer will mark the total capacity of 6 pitchers and 12 glasses is 21 liters. the capacity of a pitcher is 5 times that of a glass. find the capacit...

Social Studies, 02.08.2019 17:00

What did alaska and hawaii have in common in the late 1800s? a) both areas are islands in the pacific ocean. b) both areas were far from most of the...

Mathematics, 02.08.2019 17:00

Ineed like now ! simplify the expression : 7y + 3x + 3 - 2y + 6 what is the coefficient of y? what is the constant?...

Biology, 02.08.2019 17:00

What are pelvic bones in snakes an example of...

Biology, 02.08.2019 17:00

To which of the following dna sequences would the tata box binding protein bind? a. taggcgtatatagcgccttat b. cccgttaattaattaacgcgc c. gcgcttatctat...

English, 02.08.2019 17:00

What is professor moriarty’s relationship with holmes?...

Health, 02.08.2019 17:00

Aclient can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thighs b: turned i...

Mathematics, 02.08.2019 17:00

30 seconds slower than godfrey's time algebraic expression...

Mathematics, 02.08.2019 17:00

Explain how to solve the problem below. in your response, you must analyze the given information, discuss a strategy or plan to solve the problem, det...

Mathematics, 02.08.2019 17:00

What is 5 to the second power plus 2 the the fifth power plus 1...

Mathematics, 02.08.2019 17:00

What is the nature of the solution set to the following system of equations? 3x − 5y =negative -1 6x − 10y = negative-3 no solutions one solution...

Mathematics, 02.08.2019 17:00

In a sale, normal prices are reduced by 10%. natalie bought a pair of shoes for £54. what was the original price of the shoes?...

Health, 02.08.2019 17:00

Question 2: a client can be: a: to move up the bed by two care workers holding each other’s wrists and lifting the client under the back and thigh...

More questions: History Another questions