An enzyme is used to unzip they dna 3'ACTGTACCCATGTGTACTGCCC 5' explication

With an eye toward understanding DNA replication, Cornell researchers have learned how a helicase enzyme works to actually unzip the two strands of DNA. The results are published in the journal Nature. At the heart of many metabolic processes, including DNA replication, are enzymes called helicases.

Hope it helps?

Explanation:

answer; /// i believe that the correct answer is (

answergenetic engineering;