subject

English, 06.12.2021 19:30 brobertson72

Why do my brainlist answers keep disappearing? Can someone please explain this? I had 33 brainliest answer and now I have 14.

ansver

Answers: 3

Show answers

Another question on English

question

English, 21.06.2019 16:30

This is the noun or pronoun to which a pronoun refers.

Answers: 3

question

English, 21.06.2019 18:00

12. why do you think that using a conversational tone with plain language when writing businesses messages is a good idea?

Answers: 3

question

English, 22.06.2019 00:10

Tap out the stresses as you read line 9. which analysis best describes the rhythm and its effect on meaning

Answers: 1

question

English, 22.06.2019 00:30

Martin luther king jr often spoke of a day in the future when he hoped that his children would be judged not by their skin color but instead by their character. write a narrative essay about a moment in your life when you were judged by something other than the content of your character. use narrative techniques to develop experiencies, events, and characters

Answers: 2

You know the right answer?

Why do my brainlist answers keep disappearing? Can someone please explain this? I had 33 brainliest...

Questions

question

Biology, 10.03.2020 08:08

Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG has a melting temperatur...

question

Business, 10.03.2020 08:08

You own 400 shares of Stock A at a price of $60 per share, 500 shares of Stock B at $85 per share, and 900 shares of Stock C at $25 per share. The bet...

question

Mathematics, 10.03.2020 08:08

Choose the correct problem formulation: A Statistics Department is contacting alumni by telephone asking for donations to help fund a new computer lab...

question

Business, 10.03.2020 08:08

River Thames Insurance Company plans to sell $2,000,000 of euro-commercial paper with a 60-day maturity and discounted to yield 4.60% per annum (assum...

question

Social Studies, 10.03.2020 08:08

Assume that the union wage already exceeds the market-clearing wage. If the union wage is increased, holding other factors constant, then the number u...

question

Business, 10.03.2020 08:08

In which type of operations are you likely to see, at most, only minor variations in the product or service being produced using the same process and...

question

Business, 10.03.2020 08:08

The purpose of is to conceive, analyze, and creatively select channels of communication that will direct advertising messages to the right people in...

question

Physics, 10.03.2020 08:08

In terms of impulse and conservation of momentum, explain why a glass is much more likely to break if it falls onto a cement floor than if it falls on...

question

Business, 10.03.2020 08:08

Unlike manufacturers, buy products from other businesses but do not significantly alter the form of the products they buy before selling them....

question

Biology, 10.03.2020 08:09

C. Which specific biomolecule (lipid, protein, nucleic acid, carbohydrate) is each food mostly made of?...

question

Physics, 10.03.2020 08:10

A mass that weighs 8 lb stretches a spring 6 in. The system is acted on by an external force of 8 sin(8t) lb. If the mass is pulled down 3 in and then...

question

Mathematics, 10.03.2020 08:10

Which best describes how an accretionary wedge forms? Group of answer choices as a result of the accumulation of sediment and oceanic crust being scra...

question

Mathematics, 10.03.2020 08:10

You toss independently a fair coin and you count the number of tosses until the first tail appears. If this number is n, you receive 2n dollars. What...

question

Mathematics, 10.03.2020 08:10

In the xyxyx, y-plane above, the circle has center (h, k)(h, k)(, h, comma, k, )and radius 101010. What is the value of kkk ?...

question

Business, 10.03.2020 08:10

Chuck believes that his business has grown because of his personal involvement in every step of the way. What advice do you offer Chuck as he continue...

question

Mathematics, 10.03.2020 08:10

Exercise 1. Assume f : [a, b] ! R is integrable. (a) Show that if g satisfies g(x) = f(x) for all but a finite number of points in [a, b], then g is i...

question

Business, 10.03.2020 08:10

The following refers to units processed by a breakfast cereal maker in August. Compute the total equivalent units of production with respect to conver...

question

Physics, 10.03.2020 08:10

Find the dimensions of the rectangular box with largest volume if the total surface area is given as 100 cm2. (Let x, y, and z be the dimensions of th...

question

Physics, 10.03.2020 08:10

The eyes of some reptiles are sensitive to 850 nm light. If the minimum energy to trigger the receptor at this wavelength is 3.15 x 10-14 J, what is t...

question

Biology, 10.03.2020 08:10

As part of an early experiment on the secretory system, an in vitro translation system consisting only of mRNA and ribosomes resulted in secretory pro...

More questions: English Another questions