subject

Computers and Technology, 29.10.2020 05:00 michaelhal4271

2. Explain the importance of observing proper behavior in using social
networking sites.

ansver

Answers: 1

Show answers

Another question on Computers and Technology

question

Computers and Technology, 22.06.2019 15:00

This is not a factor that you should use to determine the content of your presentation. your audience your goals your purpose your technology

Answers: 1

question

Computers and Technology, 22.06.2019 19:30

When creating a presentation in libre office impress, where does the editing of slides take place? a. the slides panel b. the center panel c. the tasks panel, under the masters pages tab d. the tasks panel, under the layouts tab

Answers: 3

question

Computers and Technology, 23.06.2019 06:20

Which text function capitalizes the first letter in a string of text? question 10 options: upper capital first proper

Answers: 1

question

Computers and Technology, 23.06.2019 11:30

Auser is given read permission to a file stored on an ntfs-formatted volume. the file is then copied to a folder on the same ntfs-formatted volume where the user has been given full control permission for that folder. when the user logs on to the computer holding the file and accesses its new location via a drive letter, what is the user's effective permission to the file? a. read b. full control c. no access d. modify e. none of the above

Answers: 1

You know the right answer?

2. Explain the importance of observing proper behavior in using social
networking sites....

Questions

question

Physics, 29.12.2021 04:10

Computer simulations are used to predict the weather. A computer simulation is a kind of model. Large amounts of data are entered into the computer. T...

question

Physics, 29.12.2021 04:10

The refractive index for a transparent medium with a critical angle, c, for light travelling from the medium to air is?...

question

Physics, 29.12.2021 04:10

A 0.5 kg ball is rolling down a hill going at 4 m/s. How much force is acting on the ball if it rolled for 5 m?...

question

SAT, 29.12.2021 04:10

Which equation justifies why nine to the one third power equals the cube root of nine?....

question

Chemistry, 29.12.2021 04:10

Question 10 of 10 Which two statements describe the seismic wave known as a P-wave? O A. It causes more damage than an S-wave.

question

SAT, 29.12.2021 04:10

Which energy career pathways work with renewable energy? check all that apply....

question

SAT, 29.12.2021 04:10

A rectangular prism has a volume of 170 cubic centimeters....

question

SAT, 29.12.2021 04:10

A right angle intersects a line at point m. A right angle intersects a vertical line at point m and forms 3 angles. From top to bottom going clockwise...

question

Chemistry, 29.12.2021 04:10

if, at equilibrium, the concentration of glucose 6-phosphate is greater than the concentration of glucose 1-phosphate, is the δg′° of the reaction pos...

question

English, 29.12.2021 04:10

Who wrote the poem how do i love thee let me count the ways...

question

Mathematics, 29.12.2021 04:10

What is the greatest common factor shared by 40 and 20? Answer here SUBMIT...

question

History, 29.12.2021 04:10

what groups formed during protests of the stamp act that continued on throughout the american revolution?...

question

SAT, 29.12.2021 04:10

It is impossible to circumscribe a circle about the quadrilateral below....

question

History, 29.12.2021 04:10

In what ways did WWII-era policies deliver prosperity to white veterans and their families while preventing the same for Americans and veterans of col...

question

English, 29.12.2021 04:10

I hesitated long before I put this theory to the test of practice. I knew well that I risked death; for any drug that so potently controlled and shook...

question

SAT, 29.12.2021 04:10

The population density of orangeland is 18 orange trees per acre. Exactly 792 orange trees grow in orangeland. How many acres are in orangeland?....

question

SAT, 29.12.2021 04:10

Kent multiplies both sides of the equation below by an expression. K + startfraction 12 over k endfraction = 8 then he moves all the terms to one side...

question

SAT, 29.12.2021 04:10

Compare the character of faustus at the beginning of the play with his character at the end. How have his character traits and basic ambitions shifted...

question

Biology, 29.12.2021 04:10

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA...

question

SAT, 29.12.2021 04:10

A stone fell from the top of a cliff into the ocean. In the air, it had an average speed of 161616 \text{m/s}m/sstart text, m, slash, s, end text. In...

More questions: Computers and Technology Another questions