Computers and Technology, 17.12.2019 05:31 duhitsmiracle59

Write a python program that converts an input file in fasta format, called
"fasta. txt", to an output file in phylip format called "phylip. txt".
for example if the input file contains:

> human
accgttatac
cgatctcgca
> chimp
acggttatac
cgtacgatcg
> monkey
acctctatac
cgatcgatcc
> gorilla
atctatatac
cgatcgatcg

then the output file should be

human accgttataccgatctcgca
chimp acggttataccgtacgatcg
monkey acctctataccgatcgatcc
gorilla atctatataccgatcgatcg

fasta format has a description (indicated with a '> ') followed by 1 or
more lines of a dna sequence. phylip format has a description followed
by a single line of a dna sequence and each sequence is the same length.
for this homework, the input file will have an arbitrary number of
sequences of arbitrary, but identical, length

Answers: 2

Show answers

Another question on Computers and Technology

Computers and Technology, 23.06.2019 11:00

This chapter lists many ways in which becoming computer literate is beneficial. think about what your life will be like once you’re started in your career. what areas of computing will be most important for you to understand? how would an understanding of computer hardware and software you in working from home, working with groups in other countries and contributing your talents.

Answers: 1

Answer

Computers and Technology, 24.06.2019 05:30

If you combine two cells into one, what action are you performing? a. adding a new row or column b. splitting the cells c. removing a new row or column d. merging the cells

Answers: 2

Answer

Computers and Technology, 24.06.2019 11:00

These statements describe lists in presentation programs: a. bullets can be turned off and on. b. bullets cannot be turned off. c. bullet styles, colors, and sizes can be changed. d. lists don't have to use bullets or numbers. e. numbering styles, colors, and sizes can be changed. f. numbers can be turned off and on. g. numbers cannot be turned off. select all that apply

Answers: 2

Answer

Computers and Technology, 24.06.2019 15:50

Andy would like to create a bulleted list. how should he do this? andy should click on the bullet icon or select the bullet option from the menu and then type the list. andy should press the shift key and the 8 key at the beginning of each line of text. andy should type the text and then click on the bullet command. andy should press return and the bullets will automatically

Answers: 2

Answer

You know the right answer?

Write a python program that converts an input file in fasta format, called
"fasta. txt", to an...

Questions