subject
Biology, 22.07.2019 14:30 jennifer2129

How are the segments of a crayfish different from those of an earthworm?

ansver
Answers: 1

Another question on Biology

question
Biology, 21.06.2019 14:30
What is the first step in a life cycle of a plant reproduce sexually
Answers: 1
question
Biology, 21.06.2019 22:00
In what for do plants utilize nitrogen? why do they need nitrogen?
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 13:00
How would you expect the mrna codons that code for the amino acids that make up hemoglobin to compare between humans
Answers: 1
You know the right answer?
How are the segments of a crayfish different from those of an earthworm?...
Questions