Answers: 2
Biology, 21.06.2019 16:30
Which of the following is not a main characteristic that scientists focus on when determining which kingdom an organism belongs to
Answers: 3
Biology, 22.06.2019 05:50
Is there any species that went extinct in recent years due to natural causes (not caused by human interaction). if so, what caused it?
Answers: 3
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
Which pathway correctly represents protein synthesis?
proteins to rna to dna
rna to dna...
proteins to rna to dna
rna to dna...
Physics, 08.09.2021 16:10
Mathematics, 08.09.2021 16:20
Mathematics, 08.09.2021 16:20
Biology, 08.09.2021 16:20
Mathematics, 08.09.2021 16:20
Mathematics, 08.09.2021 16:20
Health, 08.09.2021 16:20
Mathematics, 08.09.2021 16:20
Biology, 08.09.2021 16:20
English, 08.09.2021 16:20