Answers: 1
Biology, 21.06.2019 21:30
List the advantages and disadavantages of the switch from persistent chlorinated hydrocarbon pesticides (such as ddt) to nonpersistent organophosphate pesicides. have the benefits of the switch outweighed the disadvantages? explain.
Answers: 3
Biology, 22.06.2019 11:30
Why do some dna fragments move farther than others during gel electrophoresis? a. because their shapes are different b. because they are different types of molecules c. because the samples are different colors d. because their masses are different
Answers: 2
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
The lateral hypothalamus is to as the ventromedial hypothalamus is to...
Mathematics, 29.12.2020 07:10
Mathematics, 29.12.2020 07:10
Mathematics, 29.12.2020 07:10
Social Studies, 29.12.2020 07:10
Geography, 29.12.2020 07:10
Mathematics, 29.12.2020 07:10
Mathematics, 29.12.2020 07:10