What factors would be important when thinking about the energy we will use in the future?

Areal dna molecule consists of thousands of these pairs of nucleotides. what is the pairing arrangement of the nitrogen bases

Membrane vesicles containing an internal sodium chloride (nacl) concentration of 0.14 m are placed into separate beakers each containing a different solution. the first beaker contains 0.14 m sucrose, while the second beaker contains 0.14 m calcium chloride (cacl2). the temperature is 25°c. what is the solute potential inside the vesicles, expressed in units of mpa?

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?