subject
Biology, 01.08.2019 19:30 paulinahunl17

In one or two, well-crafted paragraphs in your laboratory journal, summarize the process in which normal cells become cancer cells. your paragraph(s) must include each of the terms listed below. underline each term in your paragraph(s): apoptosis blood vessels cell cycle cell division metastasis mutations oncogenes proto-oncogenes regulated signals tumor suppressor genes

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 09:10
Research question: why are the carrots that grew on the left side of the garden larger than the carrots that grew on the right side of the garden? which hypothesis is based on this research question? a comparison of people with gardens to people without gardens will show who is likely to live longer. b. carrots are thought to be good for your eyesight and should be eaten regularly. c. carrots that are provided lots of sunlight grow to a larger size than carrots grown in the shade. d. eating fresh vegetables every day is a healthy thing to do.
Answers: 1
question
Biology, 22.06.2019 09:30
What type of plant is good for a bioassay and where can i buy it? i only have a month.
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 12:00
Label the steps for protein synthesis in order, beginning with the first steponce the protein is made, the gene for a particular trait is expressedmrna joins the ribosome, and the anticodons from trna join mrna to form a chain ofamino acidsrna polymerase unzips dna and free rna nucleotides join dna to form mrnav a chain of amino acids is formed from peptide bonds, creating a proteinmrna is transported from the nucleus of the cell to the ribosomes of the cell.
Answers: 1
You know the right answer?
In one or two, well-crafted paragraphs in your laboratory journal, summarize the process in which no...
Questions
question
English, 08.10.2021 23:50
question
Mathematics, 08.10.2021 23:50
question
English, 08.10.2021 23:50
question
Mathematics, 08.10.2021 23:50