Biology, 23.08.2019 12:20 dbhuggybearow6jng

Which of the following best describes genomics? a. a mechanism used in dna fingerprinting b. a sequence of mutant genes c. the study of cellular protein structures d. the study of genomes of organisms

Answers: 1

Show answers

Another question on Biology

Biology, 21.06.2019 16:40

Some plants rely on the wind to reproduce an example is it’s important for plants to use the forces of nature to reproduce because 1. 1a white tuft of dandelion seeds 2a spiked burrs surrounding seeds 3a hard shell on a walnut? 2. 1b require pollination to reproduce 2b reproduce only asexually 3b cannot move about freely?

Answers: 3

Answer

Biology, 22.06.2019 09:00

This is a typical grassland food web. it is also a small picture of an important cycle on earth: the carbon cycle. describe how the carbon gets into this food web. a) bacteria and fungi, the decomposers, recycle carbon from dead organisms. b) carbon is found in the grass and is passed from one level to the next in this food web. eliminate c) all living things give off carbon dioxide as a by-product of respiration and it is released into the atmosphere. d) plants use carbon dioxide as a reactant in photosynthesis, to make usable chemical energy in the form of a sugar.

Answers: 1

Answer

Biology, 22.06.2019 10:20

Aquaternary consumer species would be expected to have a smaller population than a secondary consumer species. select the best answer from the choices provided t f

Answers: 1

Answer

Biology, 22.06.2019 12:00

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?

Answers: 1

Answer

You know the right answer?

Which of the following best describes genomics? a. a mechanism used in dna fingerprinting b. a sequ...

Questions