subject
Biology, 02.07.2019 06:30 cesarcastellan9

Researchers investigating appetite distinguish between the roles played by the ventromedial hypothalamus and the lateral hypothalamus. where are these two structures located relative to one another?

ansver
Answers: 1

Another question on Biology

question
Biology, 22.06.2019 03:00
How did the discovery of the rhesus factor affect society? o more patients died from having a transfusion with the wrong rhesus factor 0 new treatments during pregnancy could prevent harm to the developing child. o less donated blood could be used in the treatment of patients. the number of blood types was reduced by half
Answers: 2
question
Biology, 22.06.2019 06:40
Which scientific design has both practical limitations and limitations due to scale? studying the effect of bleach on the growth of mold spores exposing cultures of duckweed to different intensities of light observing the replication of dna molecules with a hand lens using colored marbles to model a cross between two colors of rabbits
Answers: 2
question
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
question
Biology, 22.06.2019 20:30
How many electrons can occupy any electron orbital?
Answers: 1
You know the right answer?
Researchers investigating appetite distinguish between the roles played by the ventromedial hypothal...
Questions
question
Mathematics, 19.08.2019 07:50
question
Mathematics, 19.08.2019 07:50
question
English, 19.08.2019 07:50
question
Mathematics, 19.08.2019 07:50