Hypotheses may be generated from any of the following except

Which of the following scenarios is an example of the bottleneck effect? answers a in south africa, much of the afrikaner population is descended from a small number of dutch colonists. in this population, this is an unusually high frequency of pseudoxanthoma elasticum (pxe), an elastic tissue disorder. b four white-tailed deer are introduced to a park in finland. thirty years after their introduction scientists compare the genes in the population and find that there is no variation. c during the industrial revolution, london's air became filled with soot. as a result, birds started eating more of the lighter moths because they were easier to spot than their darker counterparts. over time, the moth population changed so that there were more darker moths than lighter ones. d 10% of the population of american alligators in an area have the recessive trait albinism. a massive flood results in the death of 80% of the population. of the remaining population, 60% have the recessive trait of albinism.

Hormones are chemical molecules produced by endocrine glands. one such endocrine gland is the thyroid gland, which synthesizes the thyroid hormone, which in turn affects the heart muscles. which two statements describe the probable reason for the function of the hormone? the cells in the heart have specific receptors that allow for the intake of hormones. the heart and the endocrine glands have the exact same types of cells. all cells make the same types of hormones. thyroid hormones show their effect on the heart by means of specialized cells. thyroid cells and cardiac cells have different dna.

Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?