![subject](/tpl/images/cats/biologiya.png)
Biology, 18.03.2022 02:00 skyrileycasting
A scientist is studying fossils of a great white shark. The scientist measures the size of the teeth and finds that sharks 10,000 years ago had an average tooth size of 8 centimeters, while modern great white sharks have an average tooth size of only 4 cm. What can the scientist conclude from these data? a. Over time, larger teeth were not an advantage to the shark population. b. Smaller teeth will cause c. a reduction in the shark population over time. Over time, the average tooth size of predators has decreased. d. The average tooth size of all fish has decreased over time.
![ansver](/tpl/images/cats/User.png)
Answers: 2
![](/tpl/images/ask_question.png)
![](/tpl/images/ask_question_mob.png)
Another question on Biology
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 00:00
As a small change in a person's dna can cause a genetic disorder
Answers: 1
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 12:00
Due i have no idea on this brainliest to the best answer. case #28104 last month, hudson national bank was robbed by an unidentified man. the robber wore gloves, a hat, and a bandana that covered his face. a security guard attempting to stop the robber was knocked unconscious in a struggle. however, the guard managed to pull the hat from the robber's head. witness accounts and security tapes led police to arrest three possible suspects. none of the suspects have alibis, but police are not certain which man is the robber. using hair samples from the hat recovered by the security guard, the crime lab did a southern blot test. hair samples were also taken from each suspect. use the suspects' hair samples to determine the guilty party. suspect a tccatcca / tccatccatcca / tcca / ggcttacctataagg / tggatggatggatggatgga suspect b tccatcca / tccatccaattg / tcca / tccatccatccatccatcca / tggatggatggatgga suspect c ttagcta / ccggtatga / aggt / cgttatcggatata / ggttaggacctatcgataga probe aggt questions answer these following questions in the essay box below. a. which suspect most likely committed the robbery? b. how do you know?
Answers: 1
![question](/tpl/images/cats/biologiya.png)
Biology, 22.06.2019 14:20
When a population split into two subgroups what is most likely to cause the subgroups to develop different traits?
Answers: 1
You know the right answer?
A scientist is studying fossils of a great white shark. The scientist measures the size of the teeth...
Questions
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 10:49
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 10:49
![question](/tpl/images/cats/istoriya.png)
History, 04.02.2020 10:49
![question](/tpl/images/cats/en.png)
English, 04.02.2020 10:49
![question](/tpl/images/cats/mat.png)
Mathematics, 04.02.2020 10:49
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/mkx.png)
![question](/tpl/images/cats/geografiya.png)
Geography, 04.02.2020 10:49
![question](/tpl/images/cats/himiya.png)
Chemistry, 04.02.2020 10:49
![question](/tpl/images/cats/biologiya.png)
Biology, 04.02.2020 10:49
![question](/tpl/images/cats/fizika.png)
![question](/tpl/images/cats/en.png)
![question](/tpl/images/cats/istoriya.png)
![question](/tpl/images/cats/mat.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/biologiya.png)
![question](/tpl/images/cats/en.png)